1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Solnce55 [7]
3 years ago
8

If carbon dioxide is needed for photosynthesis and water is plentiful, which of the following is likely to occur?

Biology
1 answer:
mylen [45]3 years ago
3 0

The right answer is D

The stomata are at the level of the epidermis of the leaves and aerial stems, the place of passage of the gases (carbon dioxide, oxygen, water vapor) which play a fundamental role in the physiology of the plant. These structures (which can be considered as "mini-organs") interactively regulate these exchanges. They are the terrestrial plants that constitute the true interface between the external atmosphere and the internal gas network.

You might be interested in
If equal masses of sand and water are heated to the same temperature, which sample will absorb more energy? base
liberstina [14]

Answer:

The sand will absorb more energy. This is because it is a solid, and more of a conductor of heat. Water on the other hand is not a conducter of heat, You can observe that even more when temperatures are equal.

Explanation:

Hope this helps :)

5 0
2 years ago
In cats, the gene for Calico (multicolored) cats is an x-linked trait that is
hichkok12 [17]

Answer:

Considering the <u>whole progeny</u> (100%), there will be

  • 25% Black male kittens, XBY
  • 0% Calico Male kittens
  • 25% Calico female kittens, XBXR

Explanation:

<u>Available data:</u>

  • The gene for Calico (multicolored) cats is an x-linked trait and codominant
  • Calico Females receive a "B" and an "R" gene, and have black and orange splotches on white coats. Their genotype is XBXR.
  • Males can only be black or orange, but never calico. Their genotype is XBY and XRY

Cross: a female calico cat with a black male

Parentals)   XBXR    x    XBY

Gametes)  XB  XR       XB   Y

Punnett square)    XB        XR

                   XB   XBXB   XBXR

                    Y      XBY      XRY  

F1) Among the whole progeny:

  •     2/4 = 50%  will be black (female XBXB and male XBY)
  •     1/4  = 25% will be Calico (female XBXR)
  •     1/4  = 25% will be Orange (male XRY)  

   Among females:

  •    1/2 = 50% of females will be black, XBXB
  •    1/2 = 50% of females will be Calico, XBXR

   Among males:

  •    1/2 = 50% of males will be black, XBY
  •    1/2 = 50% of males will be orange, XRY        
7 0
3 years ago
What units is the movement of tectonic plates measured
sukhopar [10]
You have to measure the distance between them

6 0
4 years ago
Read 2 more answers
All monosaccharides have the same basic formula, which is
Rashid [163]

Answer:

Monosaccharides are the simplest carbohydrates. Although glucose and fructose have the same molecular formula they have different structures or the atoms are arranged differently from each other and this is evident in the way they react, behave and in their properties. hope this helps

Explanation:

5 0
3 years ago
Which of the following is NOT an example of a plant adaptation towards success in
Ket [755]

Answer:

i think its A but dont take my word for it

Explanation:

5 0
3 years ago
Other questions:
  • In the deep waters of the ocean, coral reefs are found in abundance. Algae live on these coral reefs, providing nutrition and pr
    15·1 answer
  • Explain why your results of the optimal ph of the lactase enzyme make sense for the human enzyme? explain the results in terms o
    14·1 answer
  • The cell theory says all living things are composed of one or more
    7·1 answer
  • Various insects have a marvelous capacity to protect themselves by _________ the appearance of twigs and other objects in their
    15·1 answer
  • Will give brainliest plz help <br> #30
    13·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which of the body’s systems provides movements of the skeleton, organs, and maintains body temperature and posture?
    10·1 answer
  • What can occur nitrogenous bases do not pair correctly?
    14·1 answer
  • A tiny filter-feeding barnacle sticks to a whale. The whale is unaffected by this new stowaway. What type of relationship is thi
    10·1 answer
  • Number 1-8 what are they please
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!