They come from females when they make love to males.
Answer: amplitude would help measure height
low f, constant speed, long wavelength
speed = frequency x wavelength
Explanation: constant speed, low frequency
frequency = speed/wavelength; at constant speed f proportional to 1/wavelength, so low f __> long wavelength
speed = freq*wavelegth
<em>t = transfer </em>
It is used to translate mRNA by the ribosomes to make a new polypeptide.
Answer:
First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
Explanation:
