1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tekilochka [14]
3 years ago
14

In a survivably cold environment, an ectotherm is more likely to survive an extended period of food deprivation than would an eq

ually sized endotherm because the ectotherm
Biology
1 answer:
nexus9112 [7]3 years ago
8 0
In a survivable cold environment, an ectotherm is more likely to survive an extended period of food deprivation than would an equally sized endotherm because the ectotherm is using a little amount of its energy for temperature regulation.<span />
You might be interested in
Macromolecules and senescent organelles are catabolized by this subcellular structure. _____
fiasKO [112]

Answer: Lysosomes

Explanation:

 Lysosomes are the type of the organelle that digest the various non functional and the dead decay organelle. The lysosomes are the type of system which as the waste disposal in the cell by digest the material both the outside and inside material of cytoplasm of the cell.

Lysosomes are the type of the enclosed type of organelles membrane which basically contain the array of the enzymes that biological breaking all the polymers such as lipids, carbohydrates and proteins.  

8 0
2 years ago
What are some viable ways of lessening the effect that increased carbon has on the following?
Art [367]
<span>The ways for lessening the effect of increased carbon include reducing the components of the carbon footprint (the amount of carbon dioxide and other carbon compounds emitted due to the consumption of fossil fuels).</span> Air travel is one of the main components of the carbon footprint. <span>The solution for reducing the amount of carbon dioxide in the air is to burn fewer fossil fuels, but it is very difficult because the burning of fossil fuels is necessary for heating, electricity generation and transport.</span>

Power stations that burn fossil fuels to produce electricity are one of the main contributors of carbon dioxide in the atmosphere and the way to reduce it is to use less electricity which can be done by turning down the heating at home, insulating home, <span>using low-energy lamps etc.</span>

6 0
3 years ago
What is the primary difference between diffusion and osmosis
nata0808 [166]

Long answer here!

In diffusion, particles move from an area of higher concentration to one of lower concentration until equilibrium is reached. In osmosis, a semipermeable membrane is present, so only the solvent molecules are free to move to equalize concentration.

4 0
3 years ago
How does the water cycle purify water samples?
igor_vitrenko [27]
When water vapor condenses to become water again, it is relatively pure.
while it occurs during the water cycle, it can be used to purify water for drinking.

Hope this helps
6 0
3 years ago
Read 2 more answers
If the two oligonucleotides are allowed to anneal and the DNA polymerase and all substrates (4 dNTPs, etc.) are added to the mix
Lorico [155]

Answer:

d. T

Explanation:

For a given DNA sequence, the array is represented as:

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.

i.e.

5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'

*AGTGTCCAGG

Thus, the first nucleotide that will be incorporated into the DNA will be T

5 0
2 years ago
Other questions:
  • Which of the following might result in a human zygote with 45 chromosomes?A) an error in either egg or sperm meiotic anaphaseB)
    14·1 answer
  • In the datura plant, purple flower color is controlled by a dominant allele P. White flowers are found in plants homozygous for
    13·1 answer
  • One of the structures that is unique to angiosperms
    6·1 answer
  • Why do insectivorous plants trap insect while they also prepare carbohydrate by photosynthesis
    8·1 answer
  • What is the answer to number 5 and why is it corrects
    5·1 answer
  • Why is it important for mitosis (prophase, metaphase, anaphase and telophase) to
    8·1 answer
  • How do we store chemical energy and then how is it released
    6·1 answer
  • #13. Choose the best answer
    14·2 answers
  • If a flare occurs on the Sun 4 astronomical units away how much time would pass before a robot at that distance see the light fl
    14·1 answer
  • during an action potential, the relative charge across the membrane of an axon is reversed. which ion makes the largest contribu
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!