Answer: Lysosomes
Explanation:
Lysosomes are the type of the organelle that digest the various non functional and the dead decay organelle. The lysosomes are the type of system which as the waste disposal in the cell by digest the material both the outside and inside material of cytoplasm of the cell.
Lysosomes are the type of the enclosed type of organelles membrane which basically contain the array of the enzymes that biological breaking all the polymers such as lipids, carbohydrates and proteins.
<span>The ways for lessening the effect of increased carbon include reducing the components of the carbon footprint (the amount of carbon dioxide and other carbon compounds emitted due to the consumption of fossil fuels).</span> Air travel is one of the main components of the carbon footprint. <span>The solution for reducing the amount of carbon dioxide in the air is to burn fewer fossil fuels, but it is very difficult because the burning of fossil fuels is necessary for heating, electricity generation and transport.</span>
Power stations that burn fossil fuels to produce electricity are one of the main contributors of carbon dioxide in the atmosphere and the way to reduce it is to use less electricity which can be done by turning down the heating at home, insulating home, <span>using low-energy lamps etc.</span>
Long answer here!
In diffusion, particles move from an area of higher concentration to one of lower concentration until equilibrium is reached. In osmosis, a semipermeable membrane is present, so only the solvent molecules are free to move to equalize concentration.
When water vapor condenses to become water again, it is relatively pure.
while it occurs during the water cycle, it can be used to purify water for drinking.
Hope this helps
Answer:
d. T
Explanation:
For a given DNA sequence, the array is represented as:
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
And the premier; 5' GGACCTGTGA 3' attaches to the complementary base on the DNA sequence.
i.e.
5'ATCCTGGACACTGTACCATCGGTACCAATCACAGGTCCTTACAGT 3'
*AGTGTCCAGG
Thus, the first nucleotide that will be incorporated into the DNA will be T