1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Zepler [3.9K]
3 years ago
10

2. The Agawam High School band is playing some lively marches while the coaches are giving pep talks to their respective footbal

l squads. Although it is September, it is unseasonably hot (88°F/31°C) and the band uniforms are wool. Suddenly, Ryan the tuba player becomes light-headed and faints. Explain his fainting in terms of vascular events.
Biology
1 answer:
laiz [17]3 years ago
6 0

Answer:

the tuba player is over heated

Explanation:

wool mostly conserves body heat. especially in warm weather...

You might be interested in
Population growth is:
Ierofanga [76]

Answer:

B

Explanation:

We have learned of a major population crisis in China. Whereas The united states of America has the slowest population growth.

3 0
3 years ago
When looking at a stalk of celery that has been sitting in red food colored water. Sarah notices the celery has red lines runnin
SCORPION-xisa [38]
There a small amount of alcohol in celery and salt the two make a base particles that run that soaks up the food colouring
5 0
3 years ago
In an endothermic reaction, energy _____. exits the reaction is absorbed by the reaction stays the same throughout the reaction
belka [17]
In an endothermic reaction, energy is absorbed which causes the object to heat up. 
4 0
2 years ago
If a molecule’s concentration outside the cell is higher than it is inside the cell , that solution is??
slavikrds [6]

Them the solution is hypertonic. This means that the water within the cell would exit it and go outside and the cell would shrink.

6 0
3 years ago
What causes ocean water to become denser
igomit [66]
It becomes denser when decreases temperature and increases in salinity. This means that the colder and saltier ocean water is, the denser it becomes.
6 0
3 years ago
Other questions:
  • The direction of bilateral transfer between two limbs is typically:
    14·2 answers
  • What type of tissue with a matrix consisting of rows of fibroblasts that manufacture collagen fibers?
    11·1 answer
  • Where is the genetic material for all living organisms located?
    12·2 answers
  • Why would you expect an earthworm to lack an exoskeleton??
    12·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • How are bacteria different from viruses?
    13·2 answers
  • A _____ feeds on the waste of other living things.
    6·2 answers
  • Plz answer it’s due today
    10·1 answer
  • Explain this statement
    14·2 answers
  • How do bacteria associated with legumes provide nitrogen to the plant in a usable form
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!