1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Lyrx [107]
4 years ago
11

Describe how the rock cycle can illustrate the principle of conservation of matter

Biology
1 answer:
kicyunya [14]4 years ago
6 0
<span>Lava is an example of it. Being converted from a liquid to a solid after the eruption of a volcanoe. If thats what you mean.</span>
You might be interested in
Which of the following lower limb muscles plays an important role in maintaining posture?
Alona [7]
I believe the correct answer would be C. Sartorius   i believe this is the answer, after doing some research on gO0gLe.

6 0
4 years ago
Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA
Alla [95]

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

8 0
3 years ago
What factor defines all groups in the Köppen system, with the exception of dry climates? evaporation precipitation air pressure
Liula [17]

Answer:

temperature

Explanation:

I choose temperature because it tells how hot,cold,dry and warm somethings are meanwhile evaporation is when water changes from liquid to gas,so that means water gets hot.

Precipitation is when water released from the cloud to form rain,freezing rain,sleet,snow,or hail.Which means thing get cold.

Air pressure also affect evaporation, which means that water will not be able to come up of the surface of a body of water.So that means the the pressure will be pushing down on the surface of the water.

7 0
3 years ago
What is the magnitude (amplitude) of an action potential? <br> a. 30 mv <br> b. 70 mv <br> c. 100 mv
Stella [2.4K]
Option C 100mv because the membrane goes from -70 mV to +30 mV. Thus, during the action potential, the inside of the cell becomes more positive than the outside of the cell.
6 0
2 years ago
When does cell differentiation occur?
frutty [35]
Most animal cells differentiate at an early stage

8 0
3 years ago
Read 2 more answers
Other questions:
  • In humans, polydactyly (an extra finger on each hand or toe on each foot) is due to a dominant gene. When
    12·2 answers
  • When an oceanic plate collides with a continental plate:
    7·2 answers
  • The process of protein building begins with what molecule?
    13·2 answers
  • What structure is found mostly in green plant cells but not in animals
    5·1 answer
  • This cell is most likely a(n) ____________ cell based on physical features.
    8·2 answers
  • Write one scientific question about the organism in the photo of a baby chimpanzee
    6·1 answer
  • Which organelle controls all functions within the cell?
    11·2 answers
  • When food enters the digestive system, it -
    14·2 answers
  • What are some ways to deal with the population of lion fish in the Atlantic Ocean?
    15·1 answer
  • Which layer of the dermis houses the nerve endings that are sensitive to touch and pressure?.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!