1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
seropon [69]
2 years ago
14

Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Biology
1 answer:
Alla [95]2 years ago
8 0

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

You might be interested in
PLZZZZZZZZZZZZZZZZZZZZZZ HELPME I BEGGING YOU!!!
frosja888 [35]

Answer:

most likely Asthma

reasons:

decreased oxygen intake by breath (possible obstruction) and increase intake by cells due to high demand

7 0
2 years ago
Read 2 more answers
What changes would you recommend to permit expression of this eukaryotic gene in a bacterial cell?
Lera25 [3.4K]

<span>Gene Expression is the progression wherein the information from a gene is used in the combination of a functional gene product. In eukaryotic cells, genes are delimited by repressors as well as by transcriptional activators. The repressors will muddle to the specific DNA sequences and will constrain transcription.</span>

5 0
3 years ago
Some people think hydropower should be used to supply all of the electricity
ollegr [7]

Answer:

D. Hydropower can harm native aquatic populations.

Explanation:

  • Hydropower is the power of water or hydrosphere and is the cheapest and simplest form of energy.
  • The hydrosphere is a renewable source of energy and is thus non-polluting but most of the hydropower that is converted into electricity is harmful to the marine and aquatic life forms.
  • As it disturbs their habitats and created chemical and physical change in the body of water. Such as depletion of oxygen and enrichment of nutrients.
4 0
3 years ago
Which one of these would most likely be an intermediate species in an area that has been disturbed by a fire?
Pepsi [2]
Tress is probably the answer
5 0
3 years ago
View the animation below, then complete the quiz to test your knowledge of the concept. conducting of the heart
valina [46]
1. In the heart, an action potential originates in the (E) sinoatrial node.
The cardiac action potential is a term referring to the change in the membrane potential of heart cells causing the heart to contract. Cardiac action potentials are created by a group of specialized cells capable of generating automatic action potentials and are located in the right atrium of the heart. These cells are called sinoatrial node and sometimes are referred to as the natural pacemaker of the heart. This characterization originates from the fact that sinoatrial node continuously provides action potential and sets the rhythm of the heart function.

2. The sequence of travel by an action potential through the heart is (A) sinoatrial node, atrioventricular node, atrioventricular bundle, bundle branches, Purkinje fibers.
As explained above, the cardiac action potential originates from the sinoatrial node. This action potential then travels through the atrioventricular node, which belongs to the electrical conduction system of the heart and is located between the atria and the ventricles. It is responsible for the electrical connection between the right atrium and the right ventricle. The action potential then travels to the atrioventricular bundle (or bundle of His), another part of the electrical conduction system of the heart. The atrioventricular bundle transmits the electrical impulses from the atrioventricular node to the bundle branches. The bundle branches then send the signal to the Purkinje fibers which send the electrical impulses to the ventricles, causing them to contract. 

3. The correct answer is A.
The generation of an action potential in the sinoatrial node causes the contraction of the atria. When the action potential passes from the sinoatrial node to the atrioventricular node, it slows down. This causes the transport of the electrical impulse from the atria to the ventricles to slow down. This delay enables the blood (from the contraction of the atria) to fill the ventricles before their contraction. 

4. This statement is true.
The interventricular septum is a structure which divides the two ventricles of the heart and it is composed of two branches, the left bundle and the right bundle branch. When the action potential reaches the interventricular septum, it then travels to the apex of the heart from where it travels upwards along the walls of the ventricles and the ventricular contraction begins.

5. This statement is true.  
The bundle branches gradually become Purkinje fibers located in the interior of the ventricular walls. Purkinje fibers are specialized cells and are responsible for conducting cardiac action potentials from the bundle branches to the ventricular walls. This signal transduction causes the muscle of the ventricular walls to contract. 
7 0
3 years ago
Other questions:
  • Which product makes up the highest percentage of landfill waste?
    6·1 answer
  • How does overdependence on a few staple foods increase the risk of famine? staple foods have fewer calories than other foods, wh
    9·1 answer
  • Observations of organisms include
    9·2 answers
  • When organisms attempt to use the same resources
    10·1 answer
  • How does a cell avoid DNA overload ?
    5·1 answer
  • A biological membrane is selectively permeable in that it can, to some extent,control which substances pass through it. Based on
    7·1 answer
  • Define the following terms in your own words food chain, food web and energy pyramid
    7·1 answer
  • The act of doing what's best for the group is called
    12·2 answers
  • HELP ME I WILL MARK BRAINLIEST !!!!
    14·2 answers
  • Why would you use a model of DNA rather than the DNA itself to understand its structure​
    14·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!