1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
seropon [69]
2 years ago
14

Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Biology
1 answer:
Alla [95]2 years ago
8 0

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

You might be interested in
What is the main energy source that drives global climate?
marusya05 [52]

Answer:

<em>The correct option is A) solar energy</em>

Explanation:

Solar energy can be described as the energy which comes from the Sun. This energy drives many chemical reactions such as the reactions of photosynthesis and for generating electricity.

The solar energy is thought to meet the potential of all energy required in the future. The solar energy is the reason for all the climatic conditions which arise in a particular area.

7 0
3 years ago
The very large muscle which covers the top and sides of the skull from occipital bone to eyebrows:
xenn [34]
The very large muscle which covers the top and sides of the skull from occipital bone to eyebrows is called:
Occipitofrontalis
5 0
2 years ago
A researcher has identified a mutant strain of yeast whose histones are unable to be acetylated. Which of
d1i1m1o1n [39]

Answer:

The correct answer is c the mutant will show decreased levels of gene expression.

Explanation:

Histone acetyl transferase is an enzyme that helps in the transfer of acetyl group to the epsilon -NH2 group of lysine reside of histone proteins that surrounds the DNA molecule of chromosome.

  This results to make the target DNA more assecible for transcription mediated by RNA polymerase resulting the gene expression.

 On the other hand the mutant in which histones are not acetylated,transcription rate decreases as the non acetylated DNA is less assecible to RNA polymerase.

4 0
2 years ago
How many chromosomes do you get from each parent?
dsp73
You get 23 from each they contain the same genes but are slightly different. Hope this helps !!!!!!!!!!!
8 0
3 years ago
The Organization that protects workers and the workplace is.....?
inna [77]

Answer:

the police

Explanation:

7 0
3 years ago
Read 2 more answers
Other questions:
  • In addition to phospholipids, which of the following organic molecules are also a part of cellular membranes?
    7·1 answer
  • The three primary pollutant gases are_____
    10·1 answer
  • Your teacher has given you a sample of soil to examine. Would you use a dry mount or a wet mount to examine it? Explain your rea
    11·2 answers
  • Where is vitamin 3 primary stored? <br><br> A. Liver <br> B. Kidneys <br> C. Skin <br> D. Body fat
    13·1 answer
  • Do thinner sediment layers on the ocean floor mean the seafloor is older or younger in those areas?
    13·1 answer
  • Explain why the chemical released from the injured fish may not cause an alarm response in other fish species
    8·1 answer
  • What is the purpose of a cell wall
    11·1 answer
  • Do you think you can help?​
    13·2 answers
  • Sometimes errors called mutations occur during DNA replication. What are some of the possible consequences of mutations?
    14·2 answers
  • Describe the treatment goals for dialysis.
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!