1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
seropon [69]
3 years ago
14

Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Biology
1 answer:
Alla [95]3 years ago
8 0

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

You might be interested in
What effect do high temperatures have on enzymes?
adelina 88 [10]

When temperature is increased, molecules come together more frequently and with greater energy. Because chemical reactions need a certain amount of energy to occur, increasing the energy of the molecules involved in the reaction can speed up the rate at which the reaction occurs.

6 0
4 years ago
What description best explains why viruses can become more pathogenic to host that were not affected by the virus before?
ANEK [815]

Answer:

New cells are naive to the infectious cells who attack it or they are not well prepared to deal with the different scenarios. But, the cells who are attacked before has the set or sequence of the viral or bacterial genome strand been identified by them, which leads to more safety or protection from these foreign bodies.

Explanation:

  • Mechanism To attack a host cell:

The viruses and other infectious material enters and attacks the host cell, by breaching its membrane wall and installing or leaving a gene of its own inside the cell. Which then combines with the genome of the cell and it goes through the process of replication, translation etc,along with the host cell machinery. Which then spreads the specific gene strand more in the environment

  • <u>Camouflage obtained by the infectious cell to hide it self:</u>

After the genome enters the host cell at first it does not recognizes the strands or foreign cells, as they cover there body with a camouflage sort of membrane and they look more like the body cells.

  • <u>Reactions by the host cell and as a whole the body:</u>

The organisms detects the genome of the infections cells or strand, as they store the data about it in its server or database. As if the next time they were under attack then precautions will be there by the host cell to deal with it.

As for the cell who are never attacked before will be less safe to deal with these foreign bodies.

5 0
3 years ago
What has been the trend in life expectancy in India from 1881 to present day? How does the present day life expectancy in India
Lerok [7]

The life expectancy has been rising. There is an improvement by two-thirds n life expectancy age since 1881. This is the same trend generally in the developing world. This is attributed to improvement in other indicators such as sanitation, health care and literacy rates that have improved the lifestyles of the people significantly.

4 0
3 years ago
What is the most effective long-term solution to reduce the amount of carbon dioxide emissions?
zysi [14]

To help reduce amount of CO2 emissions you could start by:

Walking or cycling to near distances instead of driving. It could be a win-win, you saving money on gas and helping the planet. By walking it'll help us stay active especially for lazy people "me." Recyling and reusing house hold items is another stradegy. Throwing any cans, news papers, plastic bottles, or cardboard objects into a recyling bin will help by reducing the amount of garbage getting tossed in waste lands.

7 0
3 years ago
When water diffuses into or out of a cell, it is called?
Lubov Fominskaja [6]
It is called osmosis.
7 0
4 years ago
Other questions:
  • Research indicates that the bpa in plastics can leach into water or food when the plastic is ____.
    12·1 answer
  • Zebra mussels have the following genotypes and phenotypes. Which cross would the greatest number of heterozygous offspring. A) A
    10·1 answer
  • Which of the following is evidence for the endosymbiosis theory
    9·1 answer
  • Which best describe the storage of the genetic code​
    14·2 answers
  • What molecules are in pumpkin seeds
    7·1 answer
  • The machine that removes small plants from plug trays and transplants them
    14·1 answer
  • Where is the foramen in this diagram of a bone from the vertebral column?
    12·2 answers
  • In a certain specles, brown eyes are dominant to blue eyes. A male is heterozygous for the brown eye (B) gene and a female with
    15·1 answer
  • Anyone know this problem?
    8·2 answers
  • Please help !! For 10 points
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!