1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
seropon [69]
3 years ago
14

Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Biology
1 answer:
Alla [95]3 years ago
8 0

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

You might be interested in
What is the term for solid organic matter transported by wind, water, or glacial erosion?
Julli [10]
Sediment or sedimentation is the term used for solid organic matter transported by wind, water or glacial erosion. Usually, Sediment is formed by weathering or rock. In time, this sediments will be accumulated and formed in a place in which it will stay.
8 0
3 years ago
If water is leaving the cell what kind of solution is it in​
Naddik [55]

Answer:

A hypertonic solution

Explanation:

There is a greater concentration of solutes outside of the cell than there is inside the cell, therefore it will rush out.

3 0
3 years ago
What factor has the greatest effect on species diversity
umka2103 [35]
I believe the correct answer is natural selection.

Natural competition and the fight for “survival of the fittest” is what pushes diversity the most.
7 0
3 years ago
Guinea pig coat color is determined by a single gene. The allele for black coat color is dominant to brown. In a cross between t
Gwar [14]

Answer:

In a cross between two black-haired guinea pigs, 20 offspring are born. If both parents were heterozygous, probability would predict that approximately 1 out of 20 offspring would have brown hair

Explanation:

The two parents crossed were heterozygous dominant black coat color, after crossing 75% gives dominant black color coat while 25% gives only brown coat color homozygous

7 0
3 years ago
Please answer!! I will give you brainliest!!!!!!
Serga [27]

warm front

// answer was short so added this text //

5 0
3 years ago
Other questions:
  • The direction your palm faces while you sign is referred to as which parameter?
    13·1 answer
  • Which two structures would provide a positive identification of a plant cell under a microscope?
    10·2 answers
  • Describe, in detail, the steps for blood clotting
    8·1 answer
  • A wolf's diploid number of chromosomes is 78. How would the number of chromosomes in the wolf's body cells compare to the number
    10·1 answer
  • Which adaptation makes bipedalism possible?
    10·1 answer
  • Give an example of climate data.
    10·1 answer
  • 3. During the day, transpiration and photosynthesis are related, give reasons?<br>​
    5·2 answers
  • Fats that contain ____ double bonds are liquids at room temperature, whereas fats that contain ____ double bonds are solids at r
    6·1 answer
  • Please help it’s urgent!!! For these two questions
    5·1 answer
  • Why would dna evidence also be a type of homologous trait
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!