1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
seropon [69]
2 years ago
14

Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Biology
1 answer:
Alla [95]2 years ago
8 0

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

You might be interested in
What is Darwin’s theory of the origin of species?
Zielflug [23.3K]

Question:

<em>What is Darwin’s theory of the origin of species?</em>

Answer:

<em>The theory of evolution by natural selection, first formulated in Darwin's book "On the Origin of Species" in 1859, is the process by which organisms change over time as a result of changes in heritable physical or behavioral traits.</em>

Hope this helps!

3 0
3 years ago
The part of the brain that is responsible for balance is the _____. answers
quester [9]
The brain stem is the answer that you are looking for
5 0
3 years ago
Read 2 more answers
Is there ever a case in sexual reproduction where offspring can be genetically alike? Explain.
prisoha [69]

Answer:

No because the only case where they look the same is if the offspring is an identical twin also, an offspring takes half of each parent's genetics.

Explanation:

3 0
2 years ago
How are the three chromosomal aberrations different from each other?
Amiraneli [1.4K]

<span>1.) Deletions: A percentage of the chromosome is lost or removed. </span>

<span>2.) Duplications: A share of the chromosome is doubled, which results into an extra genetics.</span>

<span>3.) Translocations: A portion of a chromosome is relocated to an alternative chromosome.</span>

6 0
3 years ago
Read 2 more answers
What are plants and vegetables that use the Sun's energy to make food called?
Tems11 [23]

Answer:

photosynthesis

Explanation:

4 0
3 years ago
Other questions:
  • 1. Which of these processes is responsible for generating the most ATP within cellular respiration?
    5·1 answer
  • When new cells are formed through the process of mitosis, the number of chromosomes in the new cells
    5·2 answers
  • What are two main abiotic factors that affect organisms in marine ecosystems? A. Oxygen level and water temperature B. Predators
    9·1 answer
  • 1. When during the cell cycle is a cell's DNA replicated?
    7·2 answers
  • Describe the effects that enzymes can have on substrates amoeba sisters
    15·1 answer
  • If you made a Punnett square showing Gregor Mendel’s cross between true-breeding tall plants and true-breeding short plants, the
    10·1 answer
  • Why does the respiratory system need to pass oxygen to the blood?
    8·2 answers
  • Transport proteins in the cell membrane play an important role in cell transport by
    14·1 answer
  • A lizard sitting on a rock would be considered the level of organization.
    7·1 answer
  • PLEASE HELP ME !!!!!
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!