1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
seropon [69]
3 years ago
14

Decode CCGCTTTCGCTATTATAAAAAGGGCTATAACTA

Biology
1 answer:
Alla [95]3 years ago
8 0

Answer:

GGCGAAAGCGAUAAUAUUUUUCCCGAUAUUGAU. I think sorry if I'm wrong

You might be interested in
The cell membrane controls what enters and exits the cell to maintain
iren [92.7K]

Answer:

i think its D

Explanation:

if thats wrong then im sorry lol

5 0
3 years ago
Read 2 more answers
What is a cephalopod?
klio [65]

A cephalopod is a predatory-like mollusk of the large molluscan class of Cephalopodan animals. This includes cuttlefish, octopus, squid, and/or nautilus. They are animals that live in the ocean. Additionally they eat foods like fish and jellyfish on regular and customary occasions. They sometimes possess cannibalism by eating their own species, which is absolutely crazy. Anyways, I hope that this has helped you today.. :)

4 0
3 years ago
Read 2 more answers
The chemical bond that occurs from the attraction of two oppositely charged atoms is a(n) _____. a) covalent bond b) ionic bond
Sidana [21]
The chemical bond that occurs from the attraction of 2 oppositely charged atoms is an IONIC bond .
3 0
3 years ago
during photosynthesis,an energy transformation take place.which one of these happens during photosynthesis​
ololo11 [35]

Answer:

Explanation:

solar energy is harvested as chemical energy in a process that converts water and carbon dioxide to glucose. Oxygen is released as a byproduct. In cellular respiration, oxygen is used to break down glucose, releasing chemical energy and heat in the process.

5 0
3 years ago
The head of a human offspring turns down and prepares to enter the birth canal during
Black_prince [1.1K]
During the third trimester
4 0
3 years ago
Other questions:
  • In a savanna, gazelles, wildebeests, and warthogs eat grasses. Lions and cheetahs eat gazelles and wildebeests. Lions and wild d
    13·1 answer
  • A client in labor is experiencing discomfort because her fetus is in the occiput posterior position. which nursing action will h
    15·1 answer
  • Taxonomy seeks to _____.
    13·1 answer
  • The function of the beta subunit is to prevent DNA polymerase III from dissociating from the template DNA strand while still all
    8·1 answer
  • At what stage of mitosis does the amount of genetic material in each chromosome become half of what it just was?
    11·2 answers
  • A student researching a new discovery about the activity of mitochondria could find the most current and reliable information in
    14·1 answer
  • Approximately what wavelength of light is best absorbed by chlorophyll a, the pigment that participates directly in the light re
    9·1 answer
  • If thyroid hormones are not released, you can regulate body temperature by _____, which requires a greater use of _____.
    5·1 answer
  • Give any two bone names
    11·1 answer
  • I WILL GIVE BRANLIEST. PLSSS
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!