1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
madam [21]
4 years ago
5

Can somebody please helppppp ????

Biology
1 answer:
Minchanka [31]4 years ago
3 0

two is the nucleus since one is the nuclelous

You might be interested in
Which of the following is not an observation that was made by Darwin
kotykmax [81]
The first answer is D. The second answer is A.
8 0
3 years ago
Determination of the number of bacteria present in specimens is called
aniked [119]
Quantitative analysis would determine the number present.
6 0
3 years ago
1. Nucleus <br><br> 2. Cell Membrane <br><br> 3. Cytoplasm
almond37 [142]
I believe the correct answer is cytoplasm
4 0
3 years ago
At what point during mitosis has the nuclear membrane reformed?
victus00 [196]
What grade are you in?
6 0
3 years ago
Vitamin d _____.
svetlana [45]
Vitamin D plays a vital role in the regulation of calcium deposits and maintenance of the phosphorous levels in the blood which are two elements that are significantly important for maintaining healthy bones.

The human body needs vitamin D to absorb calcium in the intestines and to recover calcium that would otherwise be excreted through the kidneys. It also essential for the development and strengthening of bones and it blocks the release of parathyroid hormones.

The answer would be letter E. None of the above
5 0
3 years ago
Other questions:
  • How could the basic compounds necessary for life have been formed on early Earth? *
    11·1 answer
  • The process of diffusion and active transport are both used to
    15·2 answers
  • Which biomes would be the coldest? deciduous forests and savannas tundras and taigas deciduous forests and taigas tundras and sa
    14·2 answers
  • Which statement accurately describes sinkholes in Florida?
    13·2 answers
  • Which of the following best helps scientists determine the order in which a species evolved
    6·1 answer
  • Explain how a tea bag is an example of selective permeability
    14·2 answers
  • What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatct
    7·1 answer
  • I NEED HELP PLEASE ANSWER FAST
    9·1 answer
  • Question 25
    7·1 answer
  • If a scientific journal article is difficult to understand in its entirety, what is the best resource for comprehending the over
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!