1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ryzh [129]
3 years ago
8

Fertilizer in ponds or streams would most likely be considered point source pollution. Please select the best answer from the ch

oices provided T F
Biology
2 answers:
alexandr1967 [171]3 years ago
7 0

Answer:

its TRUE REEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE

Explanation:

mihalych1998 [28]3 years ago
3 0

Answer:

Explanation:

True I believe

You might be interested in
Can someone help me with this? Stem cells are used in which of the following types of biotechnologies?
strojnjashka [21]
The answer is B therapeutic cloning because you can use stem cells to grow any type of body part needed
4 0
3 years ago
What are the basic<br> Organs of respiratory system?
xxTIMURxx [149]

There are 3 major parts of the respiratory system: the airway, the lungs, and the muscles of respiration. The airway, which includes the nose, mouth, pharynx, larynx, trachea, bronchi, and bronchioles, carries air between the lungs and the body's exterior.

8 0
3 years ago
Read 2 more answers
Debido a la baja cantidad de calorías que utilizamos o quemamos en un día de trabajo
Delvig [45]

Answer: Se debe a que el cuerpo lleva a cabo funciones fisiológicas vitales que requieren energía.

Explanation:

Las calorías son unidades de energía aportadas por los alimentos que consumimos a diario. Puntualmente se define la cantidad de calor necesaria para aumentar en 1 grado centígrado a la temperatura de 1 gramo de agua desde 14,5 hasta 15,5. La principal fuente de calorías en los alimentos son los hidratos de carbono, luego le siguen las grasas y proteínas.

<u>Dicha energía hallada en los alimentos, es utilizada por el cuerpo para llevar a cabo distintas funciones fisiológicas vitales e importantes para que el organismo funciones correctamente</u>, como el bombeo de sangre del corazón, funcionamiento de los riñones o el actividad del cerebro, etc. Nos referimos a esto como el metabolismo basal, el cual es el valor mínimo de energía utilizada en reacciones químicas celulares para la supervivencia del organismo. Dicho metabolismo basal depende de diversos factores tales como la edad, peso, sexo, etc. Pero también, las calorías son necesarias para distintas actividades voluntarias como caminar o levantar algún objeto.

<u>Sin embargo, la forma de energía de las calorías de los alimentos es distinta a la forma de energía necesaria para llevar a cabo estas funciones fisiológicas tanto voluntarias como involuntarias.</u> Para ello, la energía de las calorías debe de convertirse a otra forma y esto ocurre comenzando primero con la digestión de los alimentos, donde luego sus nutrientes son absorbidos en el torrente sanguíneo para luego dirigirse a las células. En las mismas, ocurre un proceso llamado respiración celular, en donde se utilizan las calorías de los alimentos para sintetizar ATP (Adenosín Trifosfato), la cual es una molécula que almacena energía utilizable por parte de las células y que eventualmente impulsará y llevará a cabo todos los procesos fisiológicos y metabólicos.

Entonces, en el caso del trabajo de una oficina en el que las personas permanecen sentadas largas horas, sin mucha actividad, <u>igualmente necesitan consumir mas de 2.000 kilocalorías diarias ya que el cuerpo debe obtener esa energía para llevar a cabo las funciones de todos los órganos para mantenerlos vivos.</u>

3 0
2 years ago
Animal need ______ in order to build down or breakdown materials. A. Energy B. DNA
Shalnov [3]

Answer:

b

Explanation:

animals need energy to survive basically to breakdown materials too

5 0
3 years ago
Read 2 more answers
Which characteristic do protozoans Foraminiferans (Phylum Sarcodines) and coccolithophores (Phylum Haptophyta) have in common?
shtirl [24]

The common characteristic of those two organisms is hard spherical shells (exoskeleton).

Foraminiferans are single cell marine eukaryotes divided into granular endoplasm and transparent ectoplasm. Foraminiferans are enveloped with tests, hard shells, usually composed of calcium carbonate (sometimes from organic compounds or silica).

Coccolithophore is a unicellular, eukaryotic alga with special calcium carbonate plates (or scales) of uncertain function (coccoliths). Each unicellular alga is enclosed in its own collection of coccoliths, the which make up its exoskeleton- coccosphere.


8 0
3 years ago
Read 2 more answers
Other questions:
  • What organ is the major site for gluconeogenesis (making glucose)?
    14·1 answer
  • What do the the skin, lungs, and digestive system do when drugs enter the system?
    7·1 answer
  • Explain why the following statement is false:
    5·1 answer
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Juan rides his horse at a speed of 12 miles per hour. How long does it take Juan to travel 60 miles on his horse at this speed?
    10·2 answers
  • The restriction enzyme bamhi recognizes the dna sequence ggatcc and always cuts between the two g nucleotides. how many bases lo
    9·1 answer
  • It is impossible to overhydrate because people need as much water as they can drink to carry out ordinary body functions.
    8·1 answer
  • Which type of fungus is shown in the diagram ?
    15·1 answer
  • 6)Why do the walls of the stomach secrete hydrochloric acid?
    10·1 answer
  • Oxygen and carbon are:____.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!