Answer:
"GATGACATGGCGTCAGTCGATGCG" is the complete DNA sequence having 24 bases.
Explanation:
The shotgun sequencing is the process that is being used haphazard DNA strands arrangement. The nomenclature is given by the correspondence as it is growing rapidly. The pattern of firing is quasi accidental. In the preparation of DNA strands like 100 to 1000 base pairs, the chain alteration process is used. It can haphazardly break any DNA arrangement into many small pieces,and then can make copies that are completely identical to it.
In the direction of the applied force
Answer:
Explanation:
Cell which is the basic unit of life is affected by the interactions with biotic and abiotic factors such as temperature, sunlight. Organisms are made up of cells and they respond differently to temperature changes, sunlight, water availability. Some cell perform better at some certain range of temperature while some cannot.
Organism itself are affected by the interaction of some of this factors this include water and nutrients availability. Distribution of organism in a particular habitat is greatly influenced by availability of water and nutrients it lead to competition for survival among organism. Population density and species diversity also influence community and ecosystem. Population determines how resources is allocated in a community and it affect the activities of the organism in that domain or territory.
Answer:
Nutrients and other materials from the environment are absorbed through mycelia. The branching mycelia have a high surface-area-to-volume ratio which allows the absorption of nutrients to be more efficient. Fungi may even digest nutrients by releasing enzymes into the environment.
Explanation:
I have a strange feeling that this isn't the answer you were looking for.
