1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Licemer1 [7]
3 years ago
8

If a red blood cell has no A or B proteins on it but does have Rh proteins, what blood type is the red blood cell?

Biology
1 answer:
muminat3 years ago
5 0
O+ (O positive) if you have neither A nor B antigens but you have rhesus antigens.
You might be interested in
Put "Polygenic Traits" in a sentence
Nata [24]

Answer:

Polygenic traits are controlled by a number of separate genes.

Hope it helps! :D

4 0
3 years ago
Read 2 more answers
Match each part within the biosphere with the correct description.
Misha Larkins [42]

Answer:

Biome- A group of ecosystems with similar climate, vegetation, and wildlife

Ecosystem- All living and nonliving things in an area

Organism- A complete living thing

Community- All living things in a particular area

Population- A group of organisms of the same species in an area

7 0
3 years ago
Which of the following are behavioral adaptions for animals to survive in the extreme cold of the tundra biome?
svp [43]

Answer:

Although habitats provide food, water and shelter that animals need, there is more to survival than just the habitat.

8 0
2 years ago
Read 2 more answers
The cell is taking in substances through membrane proteins, without any energy expenditure of its own. The substances naturally
Hitman42 [59]

The right answer is facilitated diffusion.

Facilitated diffusion is a diffusion mechanism facilitated by membrane transporters. it's the spontaneous passage of molecules or ions (like the passive diffusion) through a biological membrane through transport molecules (unlike passive diffusion). This process does not consume energy (like the passive diffusion) and therefore does not involve active transportation.

6 0
3 years ago
Read 2 more answers
Viruses are essentially a strand of genetic material within a protective protein coating known as a
GuDViN [60]

Answer:

capsid

Explanation:

7 0
3 years ago
Other questions:
  • An individual who cannot access memories created before brain damage or injury is suffering from _____ amnesia.
    9·1 answer
  • The part of the experiment in which the experimental factor has been removed is referred to as the ?
    8·1 answer
  • Why is osmosis important to the survival of a cell
    13·2 answers
  • An _____ image cannot be projected and forms where light rays appear to originate
    12·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • How do I write a hypothesis in "If...then..." format?
    8·1 answer
  • He summoned to his presence a thousand hale and light-hearted friends from among the knights and dames of his court. –"The Masqu
    11·2 answers
  • Formation of the enzyme pepsinogen in the correct order
    10·1 answer
  • Science question. will give brainliest! part 4!
    8·2 answers
  • Which is the BEST example of learned behavior?
    15·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!