1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
faltersainse [42]
4 years ago
12

If cyanobacteria never evolved during earth's history, how would their absence affect the composition of earth's atmosphere?

Biology
1 answer:
Blababa [14]4 years ago
3 0
Cyanobacteria, also known as blue-green algae, are found in vast quantities in fresh and salt water. Cyanobacteria are able to conduct photosynthesis. By utilising energy from the sun, they produce carbohydrates from water and carbon dioxide. As a byproduct, they produce oxygen. So cyanobacteria provided oxygen to the atmosphere that allowed other lifeforms to develop.
You might be interested in
Select the correct answer.
malfutka [58]

Answer:

ureter, or ureters, are what Connect the kidneys to the bladder

8 0
3 years ago
Most organisms breathe using oxygen or carbon dioxide. Where do these gases come from on land?
bagirrra123 [75]

Answer:

Air

Explanation:

Because of the trees, we breath.

6 0
3 years ago
Read 2 more answers
Very small, rocky bodies that orbit the sun are called _______. group of answer choices
Brrunno [24]

Meteoroids are incredibly tiny, stony bodies that revolve around the sun. As with planets, asteroids, and comets, rocks or iron chunks called meteoroids orbit the sun.

As a meteoroid enters the atmosphere, friction warms it up, producing a brilliant trail of hot ionized gases (plasma) known as a meteor. If the item survives both its entry into the atmosphere and its landing on the ground, it is referred to as a meteorite. Asteroid pieces make up more than 99 percent of meteorites. A tiny group is known to have come from the moon, and another group is widely believed to have originated on Mars.  Although it hasn't been proven conclusively, there is also grounds to think that some are pieces of comets rocky debris.

Learn more about Meteoroids

brainly.com/question/18403449

#SPJ4

4 0
1 year ago
The concept of ""working against resistance"" is a key principle of
sergij07 [2.7K]

The key principle of muscular strength is the concept of "working against resistance. Muscular strength can be defined as the ability to exert force against resistance.

Muscular strength is the maximal force that one skeletal muscle can exert during its contraction.

Muscular strength also refers to the increased ability to move weight and the outcome of that is muscular development.

Resistance training is a type of physical exercise based on muscular contractions aimed at building strength, endurance and size of the skeletal muscles.

Learn more in:

brainly.com/question/12088161?referrer=searchResults

7 0
2 years ago
What are similarities between rotation andrevolution?
marishachu [46]
Rotation<span> is when a planet or moon turns all the way around or spins on its axis one time. eg. A top that spind around its own axis or turning a screw.</span><span> </span>Revolution<span> is the movement of one object around a center or another object.</span>
8 0
3 years ago
Other questions:
  • What is the overall chemical reaction for photosynthesis? in which organelle does photosynthesis occur?
    13·1 answer
  • The table below shows the amount of carbohydrates in similar servings of different fruits.
    15·2 answers
  • The process used to convert seawater into freshwater is known as
    10·1 answer
  • Do convection currents connect the poles all the way to the equator?
    8·1 answer
  • Ecosystem
    8·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Due today kinda need help
    12·1 answer
  • Technology has improved the accuracy of weather
    11·1 answer
  • Which of the following statements describes one way that energy is transferred in a food web? * Plants provide energy to consume
    7·1 answer
  • How would siamangs be affected if the rain forests they live in<br> produced less fruit?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!