1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Anit [1.1K]
3 years ago
9

Describe the structures of proteins and nucleic acids, and then explain the relationship between these two molecules within a ce

ll.
Biology
1 answer:
barxatty [35]3 years ago
4 0
<span>Proteins are large biological molecules consisting of one or more chains of amino acids.  Proteins differ from one another primarily in their sequence of amino acids, which is decided by the nucleotide sequence of their make-up, and which usually results in folding of the protein into a three-dimensional structure that determines its job. 
    </span><span>Nucleic acids are linear polymers (chains) of nucleotides. Each nucleotide consists of three things: a purine , nitrogenous base a pentose sugar, and a phosphate group.  
    </span><span>
 Basically Proteins are chains of amino acids, nucleic acids are chains of nucleosides (base+sugar+phosphate), and the sequence of nucleic acid results in the specific sequence of amino acids in the protein, finnally determining its shape and function. </span>
You might be interested in
What is true of systems in terms of their size and boundaries?
Misha Larkins [42]
A system is contained by its boundary; therefore, the size of a system is limited by its boundary.
5 0
3 years ago
How is radioactive dating important for providing evidence of evolution?
jeyben [28]

Answer:

radioactive dating? what the hell is that?

Explanation:

7 0
2 years ago
Reverse genetics can be useful for: Question 4 options: Determining the function of a gene Forensic analysis Cloning desirable a
givi [52]

The molecular biology technique of reverse genetics can be useful for determining the function of a gene.

<h3>What is reverse genetics?</h3>

Reverse genetics is method use in molecular biology to determine gene function in an organism

The procedure in reverse genetics involves modifying or certain nucleotide sequences in the DNA coding for a functional gene and then observing changes to the phenotype of the organism brought about by the modifications.

Therefore, reverse genetics can be useful for determining the function of a gene.

Learn more about reverse genetics at: brainly.com/question/9896589

8 0
2 years ago
A biologist has been studying two populations of trout in Montana for the last 25 years, when the two populations were establish
ludmilkaskok [199]

Answer:

Positive natural selection.

Explanation:

The positive natural selection is a type of natural selection that increases the frequency of an allele or trait when it is advantageous for the population. What happened in the example is that the mouth with the slight change in  morphology (trait)  was more advantageous for the population in the south in relation to the  ancestral morphology  (still preserved in the population in the north), and therefore its frequency increased. This, in turn, is due to the fact that the food (prey) is not the same in the two habitats (north and south).  The specific prey in the south,  caused the new morphology to be selected, (increasing the frequency of individuals with the new mouth),  becasue probably that trait allows the trouts in the south to hunt more effectively.

8 0
3 years ago
Who creates best management practices? Why?
goldenfox [79]

Answer:

Best management practices (BMPs) are methods that have been determined to be the most effective and practical means of preventing or reducing non-point source pollution to help achieve water quality goals. BMPS include both measures to prevent pollution and measures to mitigate pollution

6 0
3 years ago
Other questions:
  • Legumes, a type of plant, require Rhizobia, a type of soil bacteria, to survive since these organisms fix nitrogen during photos
    5·2 answers
  • What is the meaning of transpiration?
    10·2 answers
  • Which is an example of a chemical reaction
    14·2 answers
  • How would temperature affect sound in the ocean?
    7·1 answer
  • Which of the following is not a reason that introduced species are a threat to biodiversity? (1 point)
    9·1 answer
  • Which of the following best explains how human activities can directly contribute to landslides
    6·1 answer
  • This a question that you need to apply knowledge of both the digestive system AND biochemistry. You eat
    5·1 answer
  • ________________ and ___________________ provide support, protection &amp; definite shape to the body.
    10·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
  • Pulmonary edema and impaired ventilation occur during.
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!