1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kodGreya [7K]
3 years ago
7

How does energy change from one form to another?

Biology
2 answers:
SVEN [57.7K]3 years ago
8 0

Answer:

Energy transformation, also known as energy conversion, is the process of changing energy from one form to another.

Explanation:

Energy transformation, also known as energy conversion, is the process of changing energy from one form to another.  For example, to heat a home, the furnace burns fuel, whose chemical potential energy is converted into thermal energy, which is then transferred to the home's air to raise its temperature.

Rudik [331]3 years ago
8 0

Answer:

energy conversion.

Explanation:

Energy transformation, also known as energy conversion, is the process of changing energy from one form to another. ... For example, to heat a home, the furnace burns fuel, whose chemical potential energy is converted into thermal energy, which is then transferred to the home's air to raise its temperature.

You might be interested in
Will give brainliest! Please give the correct awnser.
Lyrx [107]

The answer is C. Population size

7 0
2 years ago
Read 2 more answers
Why is dna smaller than rna?
Elis [28]
No it’s the other way around .

RNA is much shorter than DNA. DNA contains the code for making lots and lots of different proteins. Messenger RNA contains the information to make just one single polypeptide chain - in other words for just one protein, or even just a part of a protein if it is made up of more than one polypeptide chain.
7 0
2 years ago
Read 2 more answers
What will happen to a population of predators if there is a sudden, temporary increase in the number of prey?
alekssr [168]
The number of predators and preys change from time to time following cycles. Whenever there is fewer prey, predators start dying because they have not enough to eat; however, that provokes the population of prey to be increased while there are fewer predators. So if suddenly the number of prey gets bigger, regardless of the number of predators, the cycles get disturbed by this sudden occurrence. The predators will get more to hunt, therefore getting more violent.
3 0
3 years ago
Okay guys i need help
Alborosie

Answer:

b.

Explanation:

because the occur will mostly cross

8 0
3 years ago
What is the term for the separation of genetic material of a cell into two daughter cells?
Paladinen [302]
Idk honestly need more information
4 0
3 years ago
Read 2 more answers
Other questions:
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Describe the pathway a sperm cell travels beginning where it forms in the testes?
    11·1 answer
  • Every time there is a full moon, Mrs. Cook insists that students in her classes display strange behavior. What would be the best
    11·1 answer
  • The trait for flower color in a plant has red and white alleles. The red color is the dominant trait. What is the phenotypic rat
    5·1 answer
  • 34. Enzymes produced by human cells generally work best at temperatures close to​
    7·1 answer
  • Aging effects all of the body's cells; and therefore, the basic building blocks of tissues. As your body ages, many tissues ____
    11·2 answers
  • Select all that apply.
    11·2 answers
  • What does "sole" mean in this passage
    13·2 answers
  • When water experiences gravity and moves to streams, creeks, and rivers
    8·1 answer
  • How does the Immune System react to HIV?
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!