All categories

3 years ago

Ben observes that his car will not start. What is a good testable hypothesis?

Biology

2 answers:

Eva8 [605]3 years ago

7 0

3 the only one that makes sense is The car is out of gas and one wouldn't do because that is the problem

lianna [129]3 years ago

7 0

Answer:

The correct answer is 3.The car is out of gasoline.

Explanation:

A good testable hypothesis for a car that will not start would be that the car do not contain the fuel to start because any car requires fuel to get started.

So gasoline is a fuel which is also known as petroleum and is widely used as the fuel source for vehicles all over the world. So when any car becomes out of gasoline that car will not start because there will be no energy source to start the engine of the car.

Therefore the car is out of gasoline is a good testable hypothesis for ben who observed that his car will not start.

You might be interested in

After suffering a head injury, amanda was taken to a medical clinic where recording electrodes were placed directly on amanda's

My name is Ann [436]

<span>It is most likely that the clinic had Amanda doing an EEG, or an Electroencephalography, which can help to show if there has been any trauma or injury to the brain. An EEG measures electrical activity in the brain by picking up on the signals from the surface of the scalp through electrodes.</span>

8 0

3 years ago

If a new body of evidence is found that directly contradicts the cell theory, committees of scientists must then

pishuonlain [190]

Answer: D

Explanation:

4 0

3 years ago

How are you part of the carbon cycle? How do you obtain carbon from the enviroment? How do you return carbon to the environment?

dimaraw [331]

Answer:

We obtain carbon through cellular respiration and return by excretion through the nose

7 0

3 years ago

AUUUAACUGUUCUGUCUAGAG

Lana71 [14]

Answer: three sets: ile. leu,phe,cys,leu,glu. glu,ile,cys,leu,val,asp,leu

The most likely sequence to be included is the R to L read, because of the STOP codon if read L to R. The lone ile would be the last amino acid of a different polypeptide, and there is no promoter sequence after the STOP codon.

Explanation:

auu,uaa,cug,uuc,ugu,cua,gag

Ile,STOP,leu,phe,cys,leu,glu

glu,ile,cys,leu,val,asp,leu (reverse)

After a STOP codon, a DNA promoter is required

5 0

3 years ago

The restriction point is defined best as the point in the cell cycle a. where cells stop progressing through the cell cycle rega

dexar [7]

Answer:

The correct answer is option c.

Explanation:

The G1 phase of the cell cycle refers to the initial phase of the cell cycle or the first phase of the cell division that needs some additional growth element called mitogen in order to carry on the process. However, these mitogens are needed until the cell attains a particular state in the G1 phase.

If the mitogens are withdrawn prior to that state, the cell cycle will get an arrest. Once the cell has reached and passed that state it becomes completely independent of mitogen and does not care for the presence of mitogen. This state is called restriction point, which usually takes place in late G1 phase.

After passing the restriction point, the cell is destined to go through the process of mitosis regardless of the absence of existence of mitogen. Thus, the correct answer is option c.

3 0

3 years ago