1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Black_prince [1.1K]
3 years ago
12

Speece and Brent concluded that most studies of children's understandings of death have found that most children understand the

key bioscientific sib-concept of death by the age of _______.
Biology
2 answers:
inessss [21]3 years ago
6 0

Answer:

The answer should be AGE 7

Explanation:

At age 4 Children starts to understand death's entirety. Study reveals that at about age 3, 10 percent of children understand finality against 58 percent of 4-year-olds. As time goes on the remaining two facets of death are learned as time goes on at the age 7.

AlladinOne [14]3 years ago
4 0

Answer:7 years

Explanation:Seven years

By seven years of age most children understand each of the key bioscientific.

You might be interested in
Jordon had surgery to repair her outer ear. What is the medical term for this surgery?
Mars2501 [29]
Ossiculoplasty is the term to repair the outer ear.
7 0
3 years ago
Read 2 more answers
Classify the organisms based on how they obtain food.
Snezhnost [94]

everything except for the carrots, trees and the ocean picture of algae is under heterotrophs

8 0
3 years ago
Read 2 more answers
Two students set up the following apparatus in a lab: a pipette was filled with a mixture of yeast and apple juice and inverted
UkoKoshka [18]

Answer:

The most appropriate answer would be carbon dioxide and cellular respiration.

Yeast is a single-celled eukaryotic organism which is capable of doing anaerobic (fermentation) as well as aerobic respiration.

It uses cellular respiration (whether aerobic or anaerobic) for the production of energy, that is, adenosine triphosphate (ATP).

Cellular respiration refers to the set of chemical reactions which are involved in breaking down sugar or glucose to produce ATP. The carbon dioxide is produced as a byproduct.

Thus, yeast breakdown the sugar present in apple juice to produce ATP and carbon dioxide.

This carbon dioxide is released in the form of bubbles.

4 0
3 years ago
Read 2 more answers
Genetic engineering can be used to disrupt specific genes in the genome of an organism. Predict how the browning of apple slices
adell [148]

Answer: Fruit will not brown. Browning requires a functional enzyme.

Explanation:

Genetic engineering refers to the manipulation of an organism's genes. Scientists use a variety of molecular tools and techniques to cut up and join genetic material from different species and to introduce this new hybrid DNA into another organisms. <u>The overall goal is to add or remove an organism's genetic makeup for the better, or to transfer DNA code from one species into the other, in order to form new combinations or heritable genetic material.</u>

Enzymatic browning is a reaction that occurs in fruits which results in negative effects on characteristics such as taste, color, and nutritional value. This reaction is a caused by phenolic compounds' oxidation by an enzyme called polyphenol oxidase, which causes the generation of dark pigments. This is often seen in apples which are rich in this enzymes and susceptible to this enzymatic browning.

If through genetic engineering, the gene encoding the enzyme responsible for the apple browing is removed, then this enzyme cannot be produced by the apple. Consequently, apples will not brown<u>,</u> because there will not be a polyphenol oxidase that oxidates the phenolic compounds.

4 0
3 years ago
A water-soluble hormone approaches its target cell. Which of the following happens first?
True [87]
The hormone signal will be transduced through the cytoplasm of the target cell.
8 0
3 years ago
Other questions:
  • Match each description to the type of relationship it represents.
    10·1 answer
  • The nurse is calculating the urinary output for the infant. the infant’s diaper weighed 40 grams prior to placing the diaper on
    7·1 answer
  • Nurse darla is planning care for ms. goodwin, who has a prolapsed cord
    8·1 answer
  • What is the composition of humus?
    7·1 answer
  • An animal cell lacking oligosaccharides on the external surface of its plasma membrane would likely be impaired in which functio
    11·1 answer
  • Chose all that apply for spring tides
    15·2 answers
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • During a recent hurricane, 25 individuals of the same butterfly species were blown onto a barrier island in southern Florida. Pr
    10·2 answers
  • An attraction between substances of the same kind is called___while an attraction between different substances is called___
    14·1 answer
  • The gravitational force exertedThe gravitational force exerted by an object depends on its by an object depends on its
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!