Which pair of chromosomes can contain two very different chromosomes and still be considered normal ?

1 answer:

6 0

I believe it would be the sex-determining chromosomes, esp X and Y. These are two very different chromosomes, but the combo of them together is normal.
<span />

You might be interested in

Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi

jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0

3 years ago

Nookie1986 [14]

An age-related change in the nervous system that can adversely affect nutritional status is decreased taste perception, hearing loss and vision loss. Aging refers to a multidimensional process in humans, the process of physical, and psychological, and social changes. As a population, older adults are more prone to age-related diseases, functional impairment, and physical inability that nay interfere with the maintenance of a good nutritional status.

4 0

4 years ago

Question 4 of 10

pogonyaev

The answer will be B. It is common sense

8 0

3 years ago

Carnivore that feeds on primary consumers

FinnZ [79.3K]

We need the options in order to answer

5 0

3 years ago

Many neurons have many short, branching extensions called dendrites. what is the benefit of these structures for a neuron

wariber [46]

The answer is the dendrites offer a big apparent area for links from other neurons. The dendrites are the main open or input areas and offer an enormous surface area for receiving signals from other neurons. They have spines appendages in which come to close interaction with synapses with other neurons.

4 0

3 years ago