<span>The main job of the large intestine is to absorb water from the undigested mass. This keeps large amounts of water in your body and helps maintain homeostasis.</span>
<span>The corpus callosum is what connects the left and right cerebral hemispheres of the brain. If it is severed, it would no longer be able to allow the two sides to communicate. In some cases, it is partially transected (severed) in patients that have severe epilepsy. The procedure is called a corpus callosotomy and is only done as a last resort.</span>
Answer:
This is a well conserved sequence.
Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved
Answer:
butterflies have different mating seasons
Explanation:
1:they have to have similar structre both internally and general appearance just like us and apes same genus different species
3: migration could vary with the habitat like lack of food in an area could lead them to migrate earlier or later
4:colour variation can also vary because of habitat since some may be darker to camouflage cause of predators like an adaptation.
Answer:
True
Explanation:
because the milk shake is with cold but milk is hot
