1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
evablogger [386]
3 years ago
12

Column A

Biology
1 answer:
Alex_Xolod [135]3 years ago
4 0
One and the letter D
You might be interested in
Wohler and Kolbe demonstrated that organic compounds, such as urea and acetic acid, could be synthesize from:
ElenaW [278]
I think the answer you’re looking for is
D. Carbon, hydrogen, and oxygen
-I hope this helps! Enjoy the rest of your day
4 0
3 years ago
"Early philosophers and naturalists used (FILL IN THE BLANK) characteristics to classify living things."
Zanzabum
Perhaps the answer is "physical characteristics". I am simply making an educated guess, however I do know early philosophers classified organisms into two groups, Plants and Animals, and identified them based on physical characteristics. 
3 0
3 years ago
If you dissected an owl pellet and found several of the skulls shown, what would you conclude is the preferred prey of this owl?
zavuch27 [327]

Answer:

The answer is C. mouse

Explanation:

I just did it on a test

8 0
4 years ago
Read 2 more answers
A mutation occurs in which a base (T) is inserted into the DNA sequence after the G, at the position marked with an asterisk, be
Zarrin [17]

A mutation which occurs when a base is introduced into the DNA sequence before transcription begins will lead to frame-shift of a single base on the DNA sequence resulting in nonfunctional protein from the transcribed mRNA.

Explanation:

This change either through addition or deletion of a single base in the codon sequences of the DNA will modify the amino acid codes and will result in nonfunctional proteins after transcription.

This mutation will just result in change of a single base, i.e., it would be added either to the enhancer region or the silencer region of the sequence before the promoter which initiates transcription.

The mRNA produced due to mutated DNA sequence after the deletion or insertion point will be read as out of frame thus resulting in nonsense protein.

8 0
3 years ago
List some common adaptations in organisms
bonufazy [111]
Some common adaptation in organisms would be:

Behavioral adaptation.
Biological adaptation.
Natural selection.

6 0
3 years ago
Other questions:
  • Many plants have leaves and fruits have wax coatings. Some animals also have wax-coated fur or
    6·1 answer
  • In all eusocial species, sterile workers assist fertile ____ with whom they share genes.
    5·1 answer
  • 1. Wind and moving water provide____ energy. A.chemical
    6·1 answer
  • Which statement correctly explains the polarity of the water molecule?
    6·1 answer
  • How are nervous response differ from hormonal response?​
    11·2 answers
  • What is the mRNA in TACCGGATGCCAGATCAAATC?
    5·1 answer
  • If you’re looking at tissue samples, how can you determine if there is cancer? What are some visual differences?
    15·2 answers
  • . <br> How does the seed of a gymnosperm differ from the seed of an angiosperm?
    8·2 answers
  • A space that contains no matter is called a(n)
    7·2 answers
  • for a particular flower the allele for red is domonaniant the allele for white is ressivepunnent square
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!