1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
vladimir1956 [14]
3 years ago
15

Many animals are grouped together in a particular environment that best satisfies their needs. Which is their likely pattern of

dispersion?
Clumped dispersion
Uniform dispersion
Random dispersion
Biology
1 answer:
Stolb23 [73]3 years ago
7 0
<span>Clumped dispersion is the most common type found in nature. The distance between neighboring individual is at a minimum. This is common among organisms that are usually preyed such as in herds or family groups. Evenly spaced distribution maximizes the distances between individuals. There is usually competition for a resource. Penguins are an example of this distribution. Random distribution or unpredictable spacing is the least common among the three. Each individual is independent of the other. They occur in environments that have consistent environmental resources and conditions. </span>
You might be interested in
When a phosphate bond is hydrolyzed, energy is released. the remaining adp is at a higher or lower energy state?
Eduardwww [97]
Answer:
The remaining ADP is at lower energy state.

Explanation:
ATP contain three phisphate bond. These phosphate groups form phosphodiester bond. Hydrolysis of each phosphate bond release about 7.3 Kcal of energy and one ADP. Now this ADP contain only one bond between phosphate group.

Result:
It is clered from the discussion that ADP is at lower energy level as compared to ATP due to less bond between phosphate group.
5 0
3 years ago
Which sample is a pure substance?
dmitriy555 [2]

Answer:

zinc oxide is a pure substance

3 0
3 years ago
Read 2 more answers
Question 5 Genetic testing is becoming more common, even for people who show no outward symptoms of a disease. Do you think it's
ArbitrLikvidat [17]

Answer:

Explanation:

It is beneficial to know if mutation is the cause of a particular ailment or an individual carries a mutated gene because it gives a clear direction on what the problem is an how it can be resolve of possible.

We have the sex cell and somatic cells, some mutation affects sex cells, while some somatic cells. If a mysterious affect sex cell there is every possibility of it being inherited by the offspring hence adequate knowledge about a mutant gene being in the body can help guide against some further re-occurence.

Negative effect is fear, it creates fear in an individual who has it.

It can lead to depression when an individual becomes traumatize due to his state.

7 0
3 years ago
Read 2 more answers
True or false? <br> Density is equal to the mass of an object divided by its volume.
kramer

Answer:

True

Explanation:

The formula for density is

p = m/v

density = mass ÷ volume

4 0
3 years ago
Read 2 more answers
To be effective, key choices must be _____. parallel broad specific diverse
Naily [24]
To be effective, key choices must be Parallel.
5 0
3 years ago
Read 2 more answers
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Explain how scientific theory differ from scientific law
    8·2 answers
  • 1. Where is the most energy found in an ATP molecule?
    14·2 answers
  • 7. Calculate: Look at the column labeled "Mean Orbital Radius (AU)" in the chart from question 6. Use a calculator to cube ("thi
    7·1 answer
  • Streptococcus pneumoniae is found as part of the normal microbiota of the mouth and pharynx and yet can cause disease in some pe
    11·1 answer
  • Some plants have stems called
    15·2 answers
  • Name the three hormones and how they affect the body
    13·1 answer
  • Which are examples of structures composed of secondary lymphoid tissue? Select all that apply.
    5·2 answers
  • Which of the following invertebrates is most closely related to the vertebrates? Select all that apply.
    10·1 answer
  • Which of these structures are found in plant cells but not animal cells?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!