1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dahasolnce [82]
3 years ago
5

A long bone is covered externally with a sheath called the __________, whereas the marrow cavity is lined with the __________.

Biology
1 answer:
vesna_86 [32]3 years ago
4 0
I suggest you to provide some options, as it's quite difficult to answer your question. Here is your answer: A long bone is covered externally with a sheath called the periosteum, whereas the marrow cavity is lined with the <span>endosteum</span>. I've attached the illustration to make it clear for you

You might be interested in
explain how a change in the sequence of nucleotide in a strand of DNA might cause a protein to malfunction
Diano4ka-milaya [45]

Answer: Proteins are made using DNA as a template. The DNA is turned into RNA, and the RNA is then turned into DNA. 

A change in these nucleotides could end up making some part of the protein different. A single nucleotide change could be silent (no change in the protein) or could change a single amino acid (amino acids are the building blocks of proteins). If that was an important amino acid, the protein might not function at all! A silent change can occur because the same set of nucleotides sometimes makes the same final amino acid (for example, reading "gcc" "gca" "gcg" or "gct" nucleotides all mean "alanine" amino acid). 

The deletion of a single nucleotide, or the addition of one, can change the entire sequence of amino acids that come after it! Nucleotides are read in sets of three, so this throws off how the DNA is read. If would be like turning "The brown fox jumps over the dog" into "The gbrow nfo xjump sove rth edo g". Completely different! All of the words are thrown off.

I know it is long but I hope it helped

:D

7 0
3 years ago
1. The basic building block of matter are atoms. Every atom is basically a tiny sphere. Every atom is composed of 2 regions, the
Cerrena [4.2K]

1. The basic building block of matter are atoms. Every atom is basically a tiny sphere. Every atom is composed of 2 regions, the outer part of the sphere is called the electron cloud and accounts for about 99.95% of the volume of an atom.

2. The electron cloud is the region of an atom in which the electron(s), are found. Electron(s), are tiny particles with a -1 electrical charge and almost no mass. Electricity is electron(s), flowing though a conductor, usually metal.  

3. Every atom is composed of 2 regions. The very tiny center part of the spherical atom is called the nucleus. The nucleus accounts for about 99.95% of the mass of the atom even though it has almost no volume.

4. Every atom has a nucleus. The nucleus contains 2 different types of particles. The particle with the +1 electrical charge is called the proton. It has almost 2000 times more mass than an electron. The number of protons in the nucleus determine how many electrons the neutral atom has and all of the chemical reactions the atom can do.  

5. Every atom has a nucleus. The nucleus contains 2 different types of particles. The particle with no (0) electrical charge is called the neutron. This particle is electrically neutral. The +1 charged protons would repel each other and destroy the nucleus if the neutrons were not neutralizing the repulsive force between the protons.  

6. When graphing how the experimental “effect” depends on the experimental “cause”, the graph can show either a direct relationship or an inverse relationship or no relationship. If the “effect” (dependent variable) value increases when we make the “cause” (independent variable) value increase, then we call this a direct relationship.  

7. When graphing how the experimental “effect” depends on the experimental “cause”, the graph can show either a direct relationship or an inverse relationship or no relationship. If the “effect” (dependent variable) value decreases when we make the “cause” (independent variable) value increase, then we call this an inverse relationship.  

8. When graphing how the experimental “effect” depends on the experimental “cause”, the graph can show either a direct relationship or an inverse relationship or no relationship. If the “effect” (dependent variable) value doesn’t change when we make the “cause” (independent variable) value increase, then we call this no relationship.  

9. An experiment needs an experimental control to validate its results. The experimental control can be one of 2 things. The experimental control can be a set of experimental conditions we repeat several times throughout the experiment. Or the experimental control can be a set of conditions which other experimenters have used and is considered “normal” or “state of the art.”

10. A variable is something which can change during an experiment. It works best when we only let 2 variables change. All the rest are kept constant and are called controlled variable(s).  

5 0
3 years ago
Are humans affected by natural selection?
Scorpion4ik [409]
Yes! A recent example could be babies that do not survive child birth for a certain reason, are obviously unable to pass on whatever caused them to die in the first place.
Also, once humans started to domesticate cows and drink their milk (I'm not sure why humans drink a cow's milk) their bodies evolved to continue making the enzyme to digest milk even after they were weaned off their mothers milk. Many people of Asian descend do not have this enzyme, since their culture did/does not raise as much dairy product. 
5 0
3 years ago
If salinity increased at the poles, the water near the poles would
Triss [41]
B is the correct answer because the density it the salts would make the water increase therefore sink faster
7 0
3 years ago
5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
stepladder [879]

I believe this is translation and it occurs in the mRNA strand due to proteins call the initiation, elongation and release factors.

7 0
3 years ago
Other questions:
  • Describe the pattern of evolution in primates. Is it linear?
    6·1 answer
  • Which of these would darwin not agree with: evolution via natural selection requires long amounts of time the idea that individu
    8·1 answer
  • Why did early scientists believe that plants were fundamentally different than animals?
    11·1 answer
  • Humans are the selective agent in which type of procces, artificial selection or natural selection
    15·1 answer
  • What is the gel-like fluid that fills the cell and surrounds the organelles?
    8·2 answers
  • Jill has been experiencing recurring periods of shortness of breath, sweating, trembling, faintness, and a feeling of unreality
    6·1 answer
  • 16. Smaller earthquakes are known as
    14·1 answer
  • Cells in Eukarya and in Archaea all have genomic DNA that is wrapped around proteins called
    10·1 answer
  • Can someone help me with this please! Asap
    14·2 answers
  • The network of connective tissue fibers which pass through the tissues of the body and allow for the efficient movement of immun
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!