1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dahasolnce [82]
3 years ago
5

A long bone is covered externally with a sheath called the __________, whereas the marrow cavity is lined with the __________.

Biology
1 answer:
vesna_86 [32]3 years ago
4 0
I suggest you to provide some options, as it's quite difficult to answer your question. Here is your answer: A long bone is covered externally with a sheath called the periosteum, whereas the marrow cavity is lined with the <span>endosteum</span>. I've attached the illustration to make it clear for you

You might be interested in
Carbon-14 has a half-life of 5730 years. A sample of wood has been recovered by an archaeologist. The sample is sent to a labora
givi [52]

Answer: 4282.928 = 4283 years

Explanation:

Data given;

Carbon 14 half life = 5740

No (initial radiation) = 0.230 Bq/g

Nf (final radiation) = 0.137 Bq/g

First we find the decimal fraction of the remaining half life of the carbon 14

k = No / Nf

k = (0.137 / 0.230) = 0.595652

So to find how many half-life has elapsed, we say

(1/2)^n = k

(1/2) ^n = 0.595652

Therefore

n log 0.5 = log 0.595652

n = ( log 0.595652) / ( log 0.5)

n = 0.747457

To get the elapsed time or how old the sample is;

We say

Carbon 14 half-life × n

5730 yrs × 0.747457

= 4282.928

= 4283 years.

So the sample of the wood is 4283 years old.

4 0
3 years ago
HELP !!!!!!!!
pshichka [43]

Answer:

I would go to option C

Explanation:

Autotrophs are organisms that can produce their own food, using materials from inorganic sources. Option C matches this definition and process.

Stay safe and Merry Christmas! :)

8 0
3 years ago
Read 2 more answers
Please help me please
forsale [732]

Answer: its a model describing features of a cells plasma membrane.

Is your answer.

Explanation: //Give thanks(and or Brainliest) if helpful (≧▽≦)//

8 0
3 years ago
If the genetically transformed cells have acquired the ability to live in the presence of the antibiotic ampicillin, then what m
V125BC [204]

Answer:

The plasmid must express a gene for ampicillin resistance (the protein product of  the <em>bla</em> gene codes for beta-lactamase, the protein that breaks down ampicillin). The colonies on the ampicillin plate are antibiotic resistant. This means that they have taken up the transformed plasmids expressing both the <em>bla</em> gene and the GFP gene.

Explanation:

The transformation involved the genetic modification of a plasmid to incorporate the gene encoding the green fluorescent protein (GFP) from jelly fish. GFP makes cells glow under UV light.

In genetic engineering, scientists use antibiotic resistance as markers to indicate cells that have been transformed. By incorporating an antibiotic resistance gene such as <em>bla</em> into the vector (plasmid) and then growing the cells in antibiotic media, scientists determine which colonies have taken up the plasmid. Therefore, if the cells survive, this means that they contain the plasmid with antibiotic resistance gene as well as the GFP gene.

5 0
3 years ago
A species of fish evolved over thousands of years to have gills that allowed the fish to swim deep in the sea. What’s the effect
SIZIF [17.4K]

Answer:

Likewise, competition for food among deep-water fish that eat the same types of food will .

Explanation:

Natural selection will condemn all deep-sea fish to the same environment that conditions them, those that cannot develop gills will be exposed to extinction, this refers to the theory of the evolution of the fittest by Charles Darwin.

6 0
3 years ago
Read 2 more answers
Other questions:
  • Who built the first microscope which allowed people to see things no one has ever seen before such as bacteria sperm in red bloo
    8·1 answer
  • A population of short-finned fish and a population of long-finned fish live in a lake. Fish with long fins swim faster than fish
    10·2 answers
  • How does the respiratory system interact with the circulatory system?
    15·1 answer
  • Organisims that have catalase What are you looking for in your observations when you are looking for evidence of a reaction? Doe
    9·1 answer
  • Which type of forest contains several kinds of cone-bearing trees and typically recieves a lot of snow in winter?
    15·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • Where do echinoderms live?
    13·2 answers
  • Which of the following is an external stimulus? O A hunger O B. sunlight O c. instinct OD. tropism​
    15·1 answer
  • A 38-year-old mother of three presents to her primary care office with complaints of fatigue. She feels that her energy level ha
    8·1 answer
  • When naming an organism using binomial nomenclature, which of the two parts of the species name are capitalized?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!