1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mkey [24]
3 years ago
13

An increase in the partial pressure of oxygen causes pulmonary arterioles to ________, thereby altering ________ to make gas exc

hange more efficient. constrict; ventilation dilate; ventilation constrict; perfusion dilate; perfusion
Biology
1 answer:
DerKrebs [107]3 years ago
5 0

Answer:

1- dilate

2- perfusion

Explanation

when blood pressure increase the arterioles dilate (become smaller) so that cells can absorb the oxygen from the blood easily. perfusion will be altered or slowed down. (The perfusion is the passage of fluid through the circulatory system. )

You might be interested in
What is the correct way to handle a needle after it is used to give a vitamin injection to a health patient?
stealth61 [152]
<span>Actually the correct method to handle the used needle is ie, It should be disposed in the right place after wrapping up it with a piece of paper or cover, which will surely avoid any type future unwanted problems to the new patients or any body and also it stops us from the spreading of unwanted diseases.</span>
4 0
3 years ago
A scientist examines the body fossil and trace fossils left by an
emmasim [6.3K]

Given what we know, we can confirm that as scientists study fossil records, they can learn much about the species, such as the traits and activities of the organisms in question.

<h3>What does each fossil type teach us?</h3>
  • Trace fossils such as footprints can teach us about the activities of the organisms.
  • Meanwhile, scientists will use body fossils to learn about the specific traits of early organisms.
  • Body fossils can at times also provide insight as to the diet of the species.

Therefore, we can confirm that scientists will use body fossils to learn more about the traits and diets of early organisms while using the uncovered trace fossils to track the activities of these organisms.

To learn more about fossils visit:

brainly.com/question/1241920?referrer=searchResults

7 0
2 years ago
Read 2 more answers
Define excretion and list the ecretory product of mammals and indicate where each product is formed​
Troyanec [42]

Answer:

Excretion is a process by which metabolic waste is eliminated from an organism. In vertebrates this is primarily carried out by the lungs, kidneys and skin. This is in contrast with secretion, where the substance may have specific tasks after leaving the cell. Excretion is an essential process in all forms of life.

Explanation:

can u mark me brainlyest

5 0
3 years ago
What adaptation does a tegument provide? Briefly describe the layers of the tegument in a Trematode.
pentagon [3]

Answer:

yhggklkbbklmbb

nnkkkj

Explanation:

बhjioihikiygu

7 0
2 years ago
In the human body which system functions in detecting and responding to stimuli? A. Endocrine B. Circulatory C. Muscular D. Nerv
fgiga [73]
In the Human body which system functions in detecting and responding to Stimuli is called the Nervous System.
3 0
3 years ago
Other questions:
  • Although the plants are living, why cannot plants grow in the dark? g
    11·1 answer
  • What does biodiversity describe?
    13·1 answer
  • 7. In a free market economy, decisions are made according to the laws of
    13·2 answers
  • Which of your fossils are most likely heterotrophs? Which of them are autotrophs? How do you know?
    8·1 answer
  • The average distance between the center of the Earth and the center of its moon is 3.84 x 108 m. The mass of the earth is
    13·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Identify the two layers that surround the sun's innermost layer. Select the two correct answers.
    7·2 answers
  • Cardinals reproduce sexually. Many types of fungi can reproduce asexually by producing spores. A fungus does not need to _______
    12·2 answers
  • Who secures a crime scene?
    7·1 answer
  • Why are ostia important to sponges?
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!