Answer:
Continental drift
Explanation:
Alfred Wagener told about continental drift. He said that continents were a single land mass called Pangaea. They were separated and relocated in the form of different continents. The drifting happens due to the movement of tectonic plates above the magma. As a result, the land mass was broken down into different landforms. These broken parts were carried slowly and form the continents. The continents are now also moving slowly
A renewable resource is a resource that can be renewed/or replinished meaning the Sustainably Harvested seafood must be your answer. Natural gas takes too long to replenish so it is considered non-renewable. You can bring back sand once it's gone nor Methane Hydrates.
Sustainably harvested seafood
hope this helped
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
