1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olga2289 [7]
3 years ago
12

Rocks above a fault plane

Biology
2 answers:
Ksivusya [100]3 years ago
7 0
We need more info to help
docker41 [41]3 years ago
4 0

What is the question being asked?

You might be interested in
Which of the following body systems is the least directly responsible for the action described below?
lyudmila [28]

Answer:

endocrine

Explanation:

i got it right on the quiz thingy. hope u got it right cause there was a time limit. haha :)

8 0
3 years ago
How will planting genetically modified crops affect chemical use on farms?
Leno4ka [110]

The correct answer is

B. Decrease chemical use

7 0
3 years ago
Some bacteria live in the roots of plants like soybeans and peas.
PIT_PIT [208]

Answer:

Nitrogen is the most commonly limiting nutrient in plants. Legumes use nitrogen fixing bacteria, specifically symbiotic rhizobia bacteria, within their root nodules to counter the limitation. Rhizobia bacteria convert nitrogen gas (N2) to ammonia (NH3) in a process called nitrogen fixation.

5 0
3 years ago
What does "chemical energy" refer to?
Effectus [21]

i think its energy that made by our body.. its form from a chemical substance (from food). The chemical energy in our body is the heat we give.

8 0
3 years ago
If a parent cell has 46 chromosomes, how many chromosomes will be present in each daughter cell after mitosis? (Multiple choice)
Aleksandr [31]

Answer:

23

Explanation:

46 unreplicated chromosomes- called daughter chromosomes - each one is essentially a chromatid. The parent cell had 46 double chromosomes (2 chromatids each)  -  which split into two in mitosis. This means that we need to divide 46 by 2 and we get 23.

Hope this helped!

Have a supercalifragilisticexpialidocious day!

7 0
2 years ago
Read 2 more answers
Other questions:
  • What is a example of allele
    13·1 answer
  • What molecule would be the most affected by limited nitrogen?
    10·2 answers
  • is fever a specific or nonspecific immune response? I need help! If you can provide an explanation, that would be great. If you
    9·1 answer
  • Can someone tell me the defination of science
    14·1 answer
  • Which of these statements is true about adaptive evolution? The ability to learn plays a key role in the process of adaptive evo
    14·1 answer
  • Please help ASAP! I'll give brainliest and 50 points if you have a great answer.
    13·2 answers
  • List the nitrogen bases that would form the complementary strand: TTCTACCCTACATAGACTCAT
    14·1 answer
  • Which is the expected outcome of combining the DNA of two parents during sexual reproduction?
    11·1 answer
  • Carrie conducted an experiment to see if listening to different types of music would affect a person’s pulse. Her hypothesis was
    7·1 answer
  • Earth's interior is composed of different layers classified by what two things?
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!