1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
kodGreya [7K]
4 years ago
10

Can someone please help

Biology
1 answer:
bija089 [108]4 years ago
3 0

Answer:

maybe to fool predators

Explanation:

You might be interested in
Which statement accurately describes the variables in this study?
mash [69]

Answer:

write full question please

5 0
3 years ago
How long will r136a1 live? ​
loris [4]

A star’s life expectancy depends on its mass. Generally, the more massive the star, the faster it burns up its fuel supply, and the shorter its life. The most massive stars can burn out and explode in a supernova after only a few million years of fusion. A star with a mass like the Sun, on the other hand, can continue fusing hydrogen for about 10 billion years. And if the star is very small, with a mass only a tenth that of the Sun, it can keep fusing hydrogen for up to a trillion years, longer than the current age of the universe.

4 0
3 years ago
The competitive exclusion principle states that two organisms cannot fill similar niches.
kap26 [50]
True. It also states that they cannot compete for the same resources.<span />
4 0
3 years ago
Read 2 more answers
How are dry and cold biomes similar and different?
Vera_Pavlovna [14]

Answer: Well for starters they have Resources that animals need and habitats where they live also certain animals belong in certain climates like if it was a cold region then snow leopards polar bears seals penguins etc. they can thrive in those regions while like bears Lions gazelles thrive and warmer and dryer regions

Explanation:

4 0
4 years ago
Why is collaboration so important in the building of scientific knowledge?
sashaice [31]

Answer:

Collaboration allows for the sharing of knowledge to better develop plans and experiments. Most of the ATP made during cellular respiration is produced in which organelle?

happy to help ☀️ Keep on shining ☀️

Explanation:

7 0
3 years ago
Other questions:
  • If you hear that a cold front is headed for your area, what type of weather might you expect
    6·2 answers
  • The atmosphere is 80% nitrogen: why do you think plants and animals can't use nitrogen as it is found in the atmosphere?
    10·2 answers
  • Scientists consider structure, biochemistry, location, reproductive habits, and many other characteristics of an organism in ord
    6·1 answer
  • What are the 4 phases of Mitosis?
    7·1 answer
  • Describe the layers of the Sun.
    6·1 answer
  • Unlike DNA, RNA contains the nitrogenous base ___
    7·1 answer
  • Suppose a family replaces ten 60-watt incandescent bulbs with ten 30-watt fluorescent lamps. If each light was used for 4 hours
    8·1 answer
  • Rachel Carson wrote in Silent Spring, "The chemical war is never won, and all life is caught in the crossfire." Respond
    11·2 answers
  • (GIVING BRAINLIEST!!)
    7·1 answer
  • The tRNA for GUCAUCGAUCGAUCGGAUGCC
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!