1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marrrta [24]
3 years ago
14

What are three ways biology has impacted the health of people around the world

Biology
2 answers:
otez555 [7]3 years ago
7 0
Preventing some illnesses, fitness level and what things we do can do to us I think
ivanzaharov [21]3 years ago
4 0

Answer:

To prevent illness, in reproduction and in beauty.

Explanation:

Learning how the human body works, doctors around the world can prevent some illness, and to invent some vacines to some virus. In reproduction, they discover new technologies of having babies, like the artificial reproduction, the artificial insemination, etc. In beauty, the doctors can help to reduce weight knowing the interactions of some products among them and with the body. Also can change the skin appereance.

You might be interested in
Which part of the stem tissue is "wood" made from?
antiseptic1488 [7]
<span>The tissue that wood is made of is xylem. It is a very important tissue for vascular plants. Why? Because of it's basic function, which is in fact to transport water from roots to shoots and leaves. However it also has another function, which is to transports some nutrients. Also, the very word, xylem, is derived from Greek, and it means "wood", and the best-known xylem tissue is in fact wood.</span>
8 0
3 years ago
During Meiosis, the alleles on each gene will separate individually into the gametes. This means that no matter what alleles wer
beks73 [17]
Indent segregation Segregation: Each inherited trait is defined by a gene pair. Parental genes are randomly separated to the sex cells so that sex cells contain only one gene of the pair. Offspring therefore inherit one genetic allele from each parent when sex cells unite in fertilization.

8 0
4 years ago
Huntington Disease is an autosomal recessive condition. Which percentage
Ksju [112]

Answer:

The options to this question are unclear but the answer is: Hh, Hh, hh, hh i.e Hh (50%), hh (50%).

Explanation:

This question involves a single Gene coding for the possession or not of Huntington's disease in humans. The disease is said to be an autosomal recessive condition i.e. it only happens in a recessive state (hh).

According to this question, when a female with Huntington disease (hh) mates with a male that is heterozygous (Hh) for the Huntington trait, the following gametes will be produced by each parent.

hh - h and h

Hh - H and h

Using these gametes in a punnet square (see attached image), the following genotypic combination of offsprings will be produced.

Hh, Hh, hh and hh

Hh = 50%

hh = 50%

Huntington Disease is Which percentage

shows the genotype probability  *

8 0
3 years ago
Arrange the events of the earliest stellar formation in sequential order.
notka56 [123]

Answer;

Arrangement of events in stellar formation;

C) The Big Bang occurs.

B) Pockets of elements in higher concentrations begin experiencing greater gravitational force.

A) Hydrogen atoms shed their electrons and fuse together to form larger helium atoms.

D) the glass clouds begin reducing in volume, which leads to increase in density, pressure, and temperature.

Explanation;

-Stellar evolution is the process by which a star changes over the course of time. All stars are born from collapsing clouds of gas and dust, often called nebulae or molecular clouds.

-Stars are born out of the gravitational collapse of cool, dense molecular clouds. As the cloud collapses, it fragments into smaller regions, which themselves contract to form stellar cores.

4 0
3 years ago
Read 2 more answers
Any variation that can help an organism survive in its environment is called a(n):
s2008m [1.1K]

Answer:

adaptation is the answer

8 0
3 years ago
Read 2 more answers
Other questions:
  • The stem of some plants serve all but one of these functions?
    11·1 answer
  • How does size affect the movement of materials across the cell membrane relate to an organismś survival?
    11·1 answer
  • In the rock cycle, what happens to the magma and lava once they cool and harden?​
    5·2 answers
  • Cancer can result from disruptions in cell cycle control. Mutations that increase the production of EGFR have been associated wi
    10·1 answer
  • Cual crees que es la ventaja de la organización social en los animales
    11·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • When ______
    10·1 answer
  • Biochemistry:cytochrome::__
    6·1 answer
  • How is globalization potentially damaging to the environment?
    10·2 answers
  • Which of the following statements are true about
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!