1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zysi [14]
3 years ago
5

All of these are fossil fuels, except:

Biology
1 answer:
iragen [17]3 years ago
8 0

Answer is <em>CHARCOAL</em>

<em> </em><em> </em><em> </em><em> </em><em>I </em><em>helped.</em><em>.</em><em>.</em><em> </em><em>pls </em><em>mark</em><em> brainliest</em>

You might be interested in
PLEASE HELP!! EASY POINTS!! WILL MARK BRAINLIEST!!!!!!
PolarNik [594]

Answer:

The cell cycle is composed of interphase (G₁, S, and G₂ phases), followed by the mitotic phase (mitosis and cytokinesis), and G₀ phase.

Explanation:

During the mitotic (M) phase, the cell separates its DNA into two sets and divides its cytoplasm, forming two new cells.

3 0
3 years ago
Rocks can best be identified by their<br> hardness<br> mineral content<br> color<br> grain
34kurt
<span>Rocks can best be identified by their mineral content. This is because rocks are composed of one or multiple numbers of minerals. Quartz, calcite, feldspars, and micas are examples of minerals that make rock formations possible.

Rocks are the basic component of the Earth's crust. Mountains, hills, and volcanoes are examples of rock formations that occur through time on Earth. One can find rocks all over the Earth and most are usually under the soil. Rocks can be further classified as igneous, sedimentary, or metamorphic rocks.</span>
3 0
4 years ago
A person has trouble coordinating muscle movements. Which two tissues could be injured?
Basile [38]

Answer:

connective; epithelial

Explanation:

3 0
3 years ago
Describe the purpose of pasteurization.
balandron [24]

Answer:

Here is some research:

The Purpose of Pasteurization

To increase milk safety for the consumer by destroying disease causing microorganisms (pathogens) that may be present in milk. To increase keeping the quality of milk products by destroying spoilage microorganisms and enzymes that contribute to the reduced quality and shelf life of milk.

>3

6 0
3 years ago
Help with 25 and 27 please asap:)
Alex777 [14]

Answer:

A

Explanation:

it clearly states so ..

7 0
3 years ago
Other questions:
  • Cardiovascular health is not influenced by "bad" cholesterol (Low-Density Lipids).
    11·1 answer
  • What effects does cell differentiation have
    9·1 answer
  • Polysaccharide structure can be varied by differences in ________.
    6·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • How do messages travel from one neuron to another
    12·1 answer
  • 1. What does "semiconservative replication" mean?
    8·1 answer
  • Biomes in Nigeria and their characteristics (five each)
    14·1 answer
  • Which two pieces of equipment did the geologist most likely use to determine the density of the copper nuggets?
    7·1 answer
  • Which point in this graph sows the beginning of a period of exponential growth? A. Point C B. Point D C. Point B D. Point A
    7·1 answer
  • Which feature is charatisic of estauries
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!