1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
valina [46]
4 years ago
6

What is the electrical charge on the plate that causes the beam to bend toward the plate

Biology
2 answers:
Andre45 [30]4 years ago
8 0

The beam was attracted to a positively charged plate and repelled by a negatively charged plate.  The particles have a positive charge.   The plates caused the beam to deflect (bend) from its straight path since it was attracted by the positively charged plate.

Dafna1 [17]4 years ago
8 0

Answer:

The electrical charge on the plate is positive.

Explanation:

The beam is a combination of cascading electrons. Since electrons are negatively charged, then the beam is negatively charged. Thus, it could either be attracted or repelled when in the neighborhood of a positive or negative charge. The law of electrostatic states that; like charge repels while unlike charge attracts. Thus, the beam was attracted to the plate because the former was positively charged. The plates caused the deflection of the beam from its initial path because it was attracted by the opposite charged plate.

Therefore, the beam was negatively charged while the plate was positively charged.

You might be interested in
What type of organism are frogs in example of?
bonufazy [111]

Answer:

Reptiles

Explanation:

Because they are cold-blooded

5 0
4 years ago
Read 2 more answers
What is the gradual sequential regrowth of a community of species after a forest fire ?
dsp73
The answer is Succession.  It is the gradual sequential regrowth of a community of species after a forest fire.  Particularly, Secondary Succession, which is the sequential replacement of species that follows disruption of an existing community (natural disaster or forest fire)
7 0
3 years ago
Chemical bonding please help!
olga_2 [115]

Answer:

A chemical bond is a lasting attraction between atoms, ions or molecules that enables the formation of chemical compounds. The bond may result from the electrostatic force of attraction between oppositely charged ions as in ionic bonds or through the sharing of electrons as in covalent bonds.

8 0
3 years ago
Which statement describes the offspring of the F1 generation when crossing a pea plant that is true breeding for green seeds wit
ololo11 [35]

Answer:

The offspring will inherit one allele from each parent

Explanation:

Just did EDGE

7 0
3 years ago
Read 2 more answers
The maximum number of individuals that a population
Ipatiy [6.2K]

Answer:

the answer would be migration

7 0
3 years ago
Other questions:
  • All living cells _____________.
    10·1 answer
  • how is the expression of sex linked genes both  similar to and different from the expression of autosomal genes?
    13·1 answer
  • The process by which an organism adjusts successfully to a specific environment is called
    9·1 answer
  • Gastric secretions digest ?​
    8·1 answer
  • Given an example of a decomposer. explain what would happen if decomposers were absent from a forest ecosystem
    14·1 answer
  • Need mRNA <br> AMINO ACIDS <br> 1.AATACGGGGGCGTAACCACTA<br> 2. GCTAGTACGTGCACATTAGAA
    5·1 answer
  • Nail production occurs at the
    12·1 answer
  • Qué produce el déficis de la isoleucina del aminoácido?
    7·1 answer
  • The pectoral girdle includes the_____
    11·1 answer
  • How to find number of alleles present in a population.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!