1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Goryan [66]
3 years ago
12

When you pushed the diaphragm up what change occurred in chest cavity pressure? Explain how this change in chest cavity pressure

affected the lungs.
Biology
1 answer:
Keith_Richards [23]3 years ago
4 0

Answer:

positive pressure

Explanation:

Exhalation is a passive process during which the intercostal muscles and the diaphragm relax. The ribs move downward and inward, while the diaphragm rises. This movement causes the chest to decrease in size and positive pressure to build inside the chest cavity. The positive pressure pushes air out of the lungs.

You might be interested in
State which type of fat is harmful to human, and what kind of bonds it has. *
Paha777 [63]

Answer:

saturated fats:single bonds

trans fat: one doubled bond

7 0
3 years ago
Read 2 more answers
An electromagnet is different from an iron magnet because ________________.
Tanzania [10]

Answer:

A

Explanation:

Electromagnet is an electrical component that when powered emits a magnetic field based on the amount of current provided. this is the same principal that runs induction motors

8 0
3 years ago
Drag each tile to the correct location.
stepladder [879]
Photosynthesis, ocean absorption, and fossilization are carbon sinks. Combustion and respiration are carbon sources
3 0
2 years ago
Which term(s) in the van deemter equation does(do) not affect the plate height?
Andru [333]
In the van deemter equation, plate height (H) = A + B/u+ Cu.
So, A, B, U, and C affects the plate height. A is the eddy diffusion term, B is the longitudinal or ordinary diffusion term, C is the nonequilibrium or resistance to mass transfer coefficient, and U is the linear velocity.
7 0
3 years ago
What are Intramembranous and endochondral ossification?
erma4kov [3.2K]

Answer:

The direct conversion of mesenchymal tissue into bone is called i<u><em>ntramembranous ossification</em></u> .The process by which a cartilage intermediate is formed and replaced by bone cells is called <em>endochondral osssification.</em>

Explanation:

Intramembranous ossification  is one of the two essential process during the fetal development  of the gnathosome skeltal system by which rudimentary bone tissue is created. It is the process of bone development from fibrous membranes. It is involved in the formation of the flat bones of the skull, mandible and the clavicle. This type of ossification also helps in healing of bone fractures.

Endochondral Osssification: Method of forming a bone through cartilage intermediate. It is also involved in the formation of long bones.

7 0
3 years ago
Other questions:
  • How is a fish similar to an oak tree
    10·1 answer
  • How do amino acids join to form proteins
    5·2 answers
  • Lists 3 characteristics that are used to describe air
    10·2 answers
  • The number of individual organisms born into a population in a given year
    12·2 answers
  • What are possible causes of extinction .????
    9·1 answer
  • Which of the following is the best explanation for the presence of light -colored lizards in the white sands region of New Mexic
    5·1 answer
  • Genetic drift _____.
    5·1 answer
  • Stored energy or energy of position is known as<br> Energy *<br> 1.)Potential<br> 2.)Kinetic
    9·2 answers
  • There are 12 pairs of curved bones called X in
    9·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!