1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
choli [55]
3 years ago
10

Describe why biodiversity increased with the introduction of sea otters in California over the last fifty years

Biology
1 answer:
Naya [18.7K]3 years ago
7 0

Answer:

Due to increment in food chains.

Explanation:

Biodiversity is actually the measure of changes in the ecosystem, genetic levels and various species levels. The sea otters introduced in California over last fifty years, increased the diversity in the ecosystem as well as in species too, thus changing the biodiversity. This was the impact of increase in food web in that particular area, the number of consumers, producers and prey increased thus increasing the biodiversity.

You might be interested in
Which property of DNA contributes the most to DNA's ability to
Artyom0805 [142]
Answer b (probably wrong)
3 0
2 years ago
A child inherits genes with the genotype: ww and Ww. What are the chances that he will have a widow's peak?
mamaluj [8]
2:2 I think I did a punnet square
8 0
3 years ago
Cool facts about blue sharks
enyata [817]
The aerodynamic shape of the blue sharks allows it to move elegantly through the ocean.
5 0
3 years ago
Read 2 more answers
1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
Natali5045456 [20]

Answer:

The answer i believe is GTAGCT?

Explanation:

I really hope you found this helpful

7 0
2 years ago
Answer the questions
solong [7]

Answer:

This is for the table at the top

<em>Plentiful roaming space</em>- increase - <u>because they</u><u> have more space they can live in.</u>

<em>Severe</em><em> </em><em>drought</em><em> </em><em>-</em><em> </em>decrease<em>-</em><em> </em><em> </em><u>because they</u><u> </u><u>wont</u><u> </u><u>have</u><u> </u><u>enough</u><u> </u><u>water</u><u> </u>

<em>abundant food </em><em>source</em><em> </em><em>-</em><em> </em>increase - <u>Because they have enough food to sustain themselves </u>

<em>Habitat </em><em>destruction</em><em> </em><em>-</em><em> </em>decrease - <u>Because they won't have a place to live in </u>

<em>Elimination of predators</em><em> </em><em>-</em><em> </em>increase - <u>Because there will be less animals hunting them for food.</u>

<em>Lack of competition</em><em> </em><em>-</em><em> </em>increase - <u>Because they won't have to compete for food which will allow them to have more.</u>

<em>Disease</em><em> </em><em>outbreak</em> - decrease - <u>Because the disease will kill a lot of them and can potentially cause birth rates to go down</u>

3 0
3 years ago
Other questions:
  • Btx depolarizes the membrane and prevents repolarization. what effect would this have on electrical signaling by the nervous sys
    10·2 answers
  • Read each of the following statements. Which statement is true?
    12·1 answer
  • True/False: Eukaryotic cells are ONLY single celled.
    9·1 answer
  • What are the similarities between photosynthesis and aerobic and anaerobic respiration?
    11·1 answer
  • What is a test variable? Give an example
    12·1 answer
  • A person cannot see a single cotton thread 100 feet away, but if you wound thousands of threads together into a rope, it would b
    7·1 answer
  • Some cancers are caused by mutations that stop certain proteins from working. The inactivation of what kind of protein could lea
    13·1 answer
  • A scientist observes a previously unknown species. It is multicellular, and has specialized sense organs. Based on the diagram o
    6·2 answers
  • What is the menstrual cycle
    11·1 answer
  • All members of kingdom fungi live off of what?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!