1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marrrta [24]
3 years ago
14

This year it snowed on five of the 12 days of Christmas the snow amounts were 3 inches ,5 inches ,7 inches ,1 foot and 9 inches

. What was the mean amount of snow for the 12 days ? Round your answer to the nearest hundredth of an inch
Mathematics
1 answer:
atroni [7]3 years ago
4 0

Answer:

Step-by-step explanation:

You might be interested in
N/A questions does not exist
Sholpan [36]

Answer:

ok

Step-by-step explanation:

why did you put it

3 0
3 years ago
I spent $10 dollars out $25 what is percent I spent
Lina20 [59]
\text {Percentage spent = }  \dfrac{10}{25} \times 100

\text {Percentage spent = }  \dfrac{2}{5} \times 100

\text {Percentage spent = }  40 \%
3 0
2 years ago
Read 2 more answers
Solve each of the following equations.
tamaranim1 [39]
A. -13
B. -45
C. 20
D. 84
E. 4
F. -4
G. -7
H. 48
6 0
3 years ago
Read 2 more answers
5 x 3 + 2 x 3 = 15 + __________
lorasvet [3.4K]
The anwser is going to be 6
5 0
2 years ago
Read 2 more answers
PLEASE HELP ME ON THIS ALGEBRA PROBLEM!!!
dexar [7]
<h3><em>y(1)=(-1)3+3x(-1)-(-1)-3</em></h3><h3><em>=-1-3+1-3</em></h3><h3><em>=-6</em></h3><h3><em>y=-6</em></h3><h3><em>x=-1</em></h3>

<em></em>

8 0
2 years ago
Other questions:
  • Need help! I suck at math , plzzz
    13·1 answer
  • What is 95% closer to 85% or 100% when rounding?
    5·2 answers
  • Plz help me my mom and dad don't know this
    5·1 answer
  • ali wants to buy a piano the piano measures 19/4 feet long she has a space 5 feet long for the paino in her house. does she have
    10·1 answer
  • Order from least to greatest 0.75 , 0.3125 , 3/8 , 9/16
    15·1 answer
  • June bought ​
    14·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • D/12 = 0.25 bbhhgshdhrjrhfbbdb
    9·1 answer
  • The radius of a circle is 25 centimeters.
    15·1 answer
  • What is the slope of the line that passes through the points (-6,8) and (-16,33)
    11·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!