1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
faltersainse [42]
2 years ago
6

Living cells are continuously making a variety of proteins. This process occurs on what organelle?

Biology
2 answers:
stepan [7]2 years ago
7 0
Riboxy Nucleic Acids or RNA
ankoles [38]2 years ago
3 0

It’s sending electrical impulses, pumping blood, filtering urine, digesting food, making protein, storing fat, and that’s just the stuff you’re not thinking about! You can do all this because you are made of cells — tiny units of life that are like specialized factories, full of machinery designed to accomplish the business of life. Cells make up every living thing, from blue whales to the archaebacteria that live inside volcanos. Just like the organisms they make up, cells can come in all shapes and sizes.

You might be interested in
Which of the following statements about cyst formation is true?
ElenaW [278]
<span>Cyst formation in a paramecium enables genetic exchange by conjugation.</span><span>

Through the reproduction of cysts, the survival of brine shrimps increase even when dealing in extreme conditions. The cysts can remain in total stasis for two years in oxygen less surroundings, they can survive freezing temperature and boiling tempreture. When conditions improve and eggs are placed in salt water, they hatch within a few hours and increase the population of brine shrimps. </span>
3 0
3 years ago
A biology teacher placed a chicken egg in vinegar to dissolve the shell exposing the cell membrane. the teacher then placed the
deff fn [24]

I would assume osmosis, as sodium chloride is just salt and salt travels to water, which is abundant in the egg.

4 0
3 years ago
Which of the following is an example of diffraction?
makkiz [27]

<u>Answer:</u>

You try to pick up a shell in the water but it isn't where it appears to be is an example of diffraction

<u>Explanation:</u>

Diffraction refers to the light bending that happens as the light passes about the edge of some object. How much bending takes place is found by the size of wavelength of light relative to that of opening. If the opening is larger than the wavelength of light, then bending will not be noticeable.

Since, light gets diffracted due to water hence the shell kept inside the water appears to be at a different position than where it actually is

8 0
3 years ago
Bones fitted together in the shape of a _____ a0 give the human body structure.
ElenaW [278]

The answer is skeleton.

Please correct me if I'm wrong!! :)

8 0
3 years ago
Read 2 more answers
This food chain is one part of of a _____ within an ecosystem.
vodka [1.7K]

The answer is community.

4 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Two plants are crossed, resulting in offspring with a 3:1 ratio for a particular trait. what does this suggest?
    7·1 answer
  • A friend declares that chromosomes are held at the metaphase plate by microtubules that push on each chromosome from opposite si
    10·1 answer
  • Assume you are working for a chemical company and are responsible for growing a yeast culture that produces ethanol. The yeasts
    8·1 answer
  • Which statement best describes connective tissue:?
    15·1 answer
  • Which feature do all adult echinoderms have?
    6·2 answers
  • How has the coqui tree frog affected the population of native species
    7·2 answers
  • Write a sentence using the word "dynasty" that clearly shows you know the meaning of the word. (THIS IS FOR HISTORY ANCIENT CHIN
    10·1 answer
  • Which can disrupt the cell cycle?<br> mutation<br> O GO phase<br> O replication<br> O cancer
    6·1 answer
  • What is typhoid fever?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!