AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
The basic type of vaccines are:
nucleic acid vaccines
subunit vaccine
live, attenuated vaccine
An easy, secure, and reliable method of preventing hazardous infections before you are exposed to them is vaccination. It boosts your immune system and builds up your body's natural defenses against particular illnesses.
Your immune system is trained by vaccinations to produce antibodies, exactly as it does when it is exposed to a disease. However, because vaccinations only include dead or weakened versions of bacteria or viruses, they do not really cause the disease or increase your chance of developing its symptoms.
In order to create immunity, vaccines act in conjunction with your body's natural defenses. Your immune system reacts when you receive a vaccination.
To know more about vaccines, visit:
brainly.com/question/6683555
#SPJ4
Answer: Antibiotic Resistant Mutation
Explanation: Not all of the bacteria die because there are individuals in the population that have an antibiotic resistant mutation, which causes them to be adapted to dealing with the antibiotic. There will be a large population of bacteria again because the ones with the mutation survive, reproduce, and pass the antibiotic resistance trait on.
Explanation:
Red and yellow bell........... - genetic diversity
A park has....... - species diversity
Five different bird..... - species diversity.
<span>connective epithelial muscular <span>nervous</span></span>
