1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irga5000 [103]
4 years ago
12

Receptors that provide animals with information from their internal environment are located in _____.

Biology
1 answer:
In-s [12.5K]4 years ago
8 0
Receptors that provide animals with information from their internal environment are located in B. BLOOD VESSELS AND ORGANS.

Chemo receptors - neurons that detect chemicals
mechanoreceptors - neurons that detect touch
olfactory receptors - neurons that detect smell
photoreceptors - neurons that detect light
thermoreceptors - neurons that deted temperature

receptors that provide animals with information from the external environment are located in their ears,skin, tongue, eyes, nose
You might be interested in
(05.01 LC)
IgorC [24]

Answer:

it should be A) Energy is created

Explanation:

cells require ATP or energy in order to continue with their cell division so ATP is created... i think?

3 0
3 years ago
Read 2 more answers
What de-polymerizes microtubules to separate sister chromatids during anaphase?
Oxana [17]

Answer:

There are two main ideas about how chromosomes move in anaphase A. One is that motor proteins at the kinetochores use the energy of ATP hydrolysis to pull the chromosomes along the kinetochore microtubules, which depolymerize as a consequence.

Explanation:

6 0
3 years ago
I student conducts an experiment to see how music affect plant growth the obtained for identical plants each one is potted in th
zavuch27 [327]

Answer:

<em>A line graph</em>

Explanation:

A line graph would be the best type of graph to show changes over time. A line graph constitutes of a y-axis and an X- axis. The presence of the axis will make is easier to look at the height changes which occur over time. The y-axis of such a graph could show the height, the X axis of such a graph could show the time. Hence, a line graph could be the best one to represent such a  change.

6 0
3 years ago
Read 2 more answers
Cite 5 examples of organisms that reproduce sexually
max2010maxim [7]
Homo sapiens
Dogs
Cats
Flies
Bees
Ants
Mouse
Chickens 
Ducks
Turtles .....etc...etc <span />
6 0
3 years ago
Can you complete this sentence for me please? . Different kind of fats contain different ________.
mrs_skeptik [129]

Different kind of fats contain different Saturated Fats.

7 0
4 years ago
Other questions:
  • A certain species of plant has four unlinked genetic loci, w, x, y, and z. each genetic locus has one dominant allele and one re
    14·1 answer
  • Growing exotic (nonnative) plant species in
    12·1 answer
  • "a nurse is evaluating the medication regimens of clients to determine whether the therapeutic levels have been achieved. for wh
    9·1 answer
  • Which function is performed by earths atmosphere
    7·2 answers
  • Bread mold is an example of which of the phyla of fungi?
    14·1 answer
  • Help please! a rising barometer indicates which of the following kinds of air masses is approaching?
    11·1 answer
  • Why does Interstate 95 seem to follow the fall line?
    8·1 answer
  • You are asked to place a nasal oxygen tube in a dog. what is the measurement for placement of nasal oxygen?
    7·1 answer
  • Which type of mutation always creates a stop codon?<br> missense<br> nonsense<br> silent<br> point
    14·2 answers
  • TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!