<h3><u>Answer;</u></h3>
It was developed by many scientists over many decades.
<h3><u>
Explanation;</u></h3>
- DNA is a type of nucleic acid that contains two long, twisted strands, known as double helix, that contain complementary genetic information.
- A gene is a segment of DNA that is passed down from parents to children and confers a trait to the offspring.
- The traits an organism displays are ultimately determined by the genes it inherited from its parents, known as genotype.
- Our understanding of DNA and inherited traits has changed over time since it has been continuously developed by many scientists over may decades.
Answer:
the number of protons, neutron and electron for a neutral atom of nitrogen is p:7E:7N:7
The property is fracture
when there is a pattern, it is cleavage
Answer:
The correct answer is - Pons.
Explanation:
The pons is located t below the midbrain and below the midbrain. It is a group of nerves that function as a connection between the cerebrum and cerebellum.
It is related to the various functions of the body such as sleeping, respiration, swallowing, bladder control, hearing, and many more. These functions
Answer:
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Explanation:
<em>The complementary strand is
:</em>
(5')GCGCAATATTTTGAGAAATATTGCGC(3')
<em>The base sequence of the complimentary strand is:</em>
(3')CGCGTTATAAAGAGTTTTATAACGCG(5')
Because this sequence is self-complementary, the individual strands can form hairpin structures. The two strands together may also form a cruciform.
Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.
- DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis, bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
- Hairpins can also be formed from double-stranded DNA as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
