1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mumz [18]
3 years ago
13

The nephron is responsible for maintaining _______. select one:

Biology
1 answer:
stiv31 [10]3 years ago
4 0
I say it is all of the above. 
You might be interested in
some biology students wanted to determine whether a pair of brown mice purchaced at a pet store was homozygous dominant of heter
lawyer [7]
Do a punnet square or something because you didn't give any info. 
6 0
4 years ago
Cells with a full set of chromosomes are referred to as diploid or 2n, whereas cells with half the chromosomes are haploid or n.
Papessa [141]

Answer:

  • Diploid → Prophase, metaphase, and anaphase
  • Haploid → Telophase

Explanation:

During prophase I,  chromosomes get condensed. Each of the chromosomes gets in pair with its homologous one. They do so to make the crossing-over possible, a stage where they interchange their parts → 2n

During metaphase I, each of the homologous pairs is driven to the equatorial plane, where they randomly line up → 2n

During anaphase I, occurs the independent separation of homologous chromosomes that migrate to opposite poles of the cell. This separation generates different chromosomal combinations in the daughter cells. There are two alternatives per homologous pair → 2n  

In telophase I, half of the chromosomes are already in one of the poles, while the other half is on the other pole. Each group of chromosomes has now half the number of the original cell. The nuclear membrane forms again in each pole → n

Finally, occurs cytokinesis, which involves the invagination of the cell membrane and cytoplasmic division.

The two new cells are ready for meiosis II.

3 0
3 years ago
Pls help (ASASP)
gogolik [260]
Sponge ? i may be wrong though
4 0
3 years ago
Read 2 more answers
Which explaims why it is important to eat full healthy meal
Ksju [112]

Answer:

Explanation:

Eating well is fundamental to good health and well-being. Healthy eating helps us to maintain a healthy weight and reduces our risk of type 2 diabetes, high blood pressure, high cholesterol and the risk of developing cardiovascular disease and some cancers.

5 0
3 years ago
Cells in humans use energy from what?
vladimir1956 [14]
The liver primarily uses fatty acid oxidation for energy. Muscle cells use fatty acids, glucose, and amino acids as energy sources. Most cells use glucose for ATP synthesis, but there are other fuel molecules equally important for maintaining the body's equilibrium or homeostasis.
3 0
3 years ago
Read 2 more answers
Other questions:
  • Which of the following is a feature of prokaryotic cells but not eukaryotic cells?A) piliB) cell wallC) flagellaD) DNA
    9·1 answer
  • A client says, "alcohol is not the cause of my problems. i can stop drinking any time i want." what is the short-term goal of th
    11·2 answers
  • The liver forms glucose from noncarbohydrates. stores vitamin
    10·1 answer
  • Some organisms in the ecosystem obtain energy and nutrients from plants these organisms stores the energy in their bodies what h
    5·1 answer
  • Water's _____ property creates positive and negative ions, which are essential for chemical reactions.
    5·1 answer
  • When is superficial anatomy most useful?
    6·1 answer
  • Which of the following molecules is a subunit of dna that links together to form strands of dna
    11·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Who's hair grows the quickest, boys or girls?
    8·1 answer
  • With today's technology how else can you disprove the theory spontaneous generation?
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!