1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
scoundrel [369]
3 years ago
10

Explain the benefits of STEM cell therapy. Be specific with examples and give a pretty brief reason.

Biology
1 answer:
irga5000 [103]3 years ago
5 0

Answer:

In stem cell transplants, stem cells replace cells damaged by chemotherapy or disease or serve as a way for the donor's immune system to fight some types of cancer and blood-related diseases, such as leukemia, lymphoma, neuroblastoma and multiple myeloma. These transplants use adult stem cells or umbilical cord blood.Explanation:

You might be interested in
Give one big reason why viruses are not alive
MatroZZZ [7]

Answer:

because we killed them and follow the virus-safe rule..?

7 0
2 years ago
Read 2 more answers
What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
Kazeer [188]
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
8 0
3 years ago
Read 2 more answers
Please help me , Describe how bonds contain energy and what the energy is used for
astraxan [27]

Answer:

Chemical bonds contain potential energy.

Explanation:

Chemical bonds always contain potential energy. The atoms of the bond want to move to a lower energy to become more stable.. The energy for breaking bonds only comes when stronger bonds are formed.  This energy is used to tear apart the bonds holding the Hydrogen atoms together. The strength of the covalent bonds depend on the overlap between the valence orbitals of the bonded Atom.

6 0
3 years ago
What is species richness?(1 point)
olganol [36]

Answer: B, the number of species in a community

Explanation:

3 0
3 years ago
What happens to phosphorus when animals die?​
nikitadnepr [17]

Answer:

phosphates will return to the soils or oceans again during decay

Hope I helped :D

4 0
2 years ago
Other questions:
  • What is the protocol for saving an amputated body part vitals signs and basic emergency?
    11·1 answer
  • The biome with the most diverse communities of organisms is the _____. A. coniferous forest B. prairie C. deciduous forest D. ra
    6·2 answers
  • What are proteins for export out of the cell?
    8·1 answer
  • Why do phospholipids form a bilayer in water?
    6·1 answer
  • Blank must consume other organisms
    13·1 answer
  • Select the correct image,
    10·1 answer
  • A family tree shows relationships and is, therefore, a good example of a natural system of classification. TrueFalse
    11·2 answers
  • Why is Trans fat not a healthy choice ?
    13·1 answer
  • WILL GIVE BRAINIEST IF THEY GIVE A CORRECT ANSWER!!! 50 POINTS!!!!<br> what eats sunbeam snakes?
    9·2 answers
  • ______ is the transfer of energy through spaces as electromagnetic waves in all directions?
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!