1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Bess [88]
3 years ago
13

What do you predict would best aid in the recovery of offshore, environmentally deteriorated seagrass communities?

Biology
2 answers:
Slav-nsk [51]3 years ago
6 0

Answer: Coastal development regulations

Explanation:

Coastal development regulations aims to protect the coastal region from deterioration from the illegitimate human activities such as overfishing, excessive boating and fishing deteriorating the quality of water, maintain the ambiance of the coastal region and ecosystem.

This will also protect the human disturbance to the already growing seagrass communities.  

inysia [295]3 years ago
4 0
Coastal development regulations
You might be interested in
Transdermal patches are intended to release a drug over an extended period of time. Particular care must be used with this type
Nat2105 [25]

Answer:

Answer is Magnetic Resonance Imaging.

Explanation:

A transdermal patch is an adhesive patch which is used medically for delivering doses of medication via the skin into the bloodstream, by simply placing the patch on the skin.

Most of the medications that can be administered through the transdermal patch are pain relievers, nicotine, hormones and contraception to prevent pregnancy.

It has been discovered that, pregnancy patch is 99% effective and last for about 7 days.

Magnetic Resonance imaging, MRI, is used to produce the image of the body, with the use of magnetic and radio wave. It is helpful in diagnosing injury or disease and monitor how well a patient is responding to treatments.

It can be used to detect spinal tumor, cancer , fracture etc. and it is safe  and easy to use.

4 0
4 years ago
What is the difference between arbitrary and natural levels? Why do these matter? (4) how do archaeologists recover the smallest
Vlada [557]

Arbitrary level refers to the fundamental vertical subdivision of an excavation square, implied only when easily identifiable natural strata are absent and when natural strata are more than ten centimeters thick.  

Natural strata refer to a vertical subdivision of an excavation square, which is reliant on the natural breaks in the sediments in terms of grain size, color, hardness, texture, or other features.  

It is important to know the difference between the arbitrary and natural levels as arbitrary levels could amalgamate artifacts from distinct natural levels, that is, of distinct geologic contexts.  

The archaeologists can recover the smallest ecofacts and artifacts with the assistance of flotation, screening, and bulk matrix processing


5 0
4 years ago
Which of the following is the correct way to include the title of a magazine article in a bibliographic entry? “Basketball’s Sur
BabaBlast [244]
That doesn’t rlly make much sense... you’d joyful search up the answer instead or HMU
4 0
3 years ago
Read 2 more answers
I'll give likes and thank yous and try to give brainiest! Which of the following organisms are capable of self feritlization?
tino4ka555 [31]

Answer:

A. Plants.

Hope it helps! =)

Brainliest?

8 0
3 years ago
Brianna is mapping trees in a section of land. She observes that some of the trees are clumped together, some are uniformly sepa
daser333 [38]
A....................................
4 0
3 years ago
Other questions:
  • The sequence of coding strand of a DNA molecule is given below. Assume that it is read from left to right. CCTACCTTATGCCAAGTTGGG
    15·1 answer
  • Which of the following are functions of the immune system? Select all that apply.
    10·1 answer
  • What is a prokaryotes in biolog
    15·1 answer
  • Recessive genes are _____.
    13·2 answers
  • The stronger the wind, the larger the particles it erodes.
    13·2 answers
  • Induced pluripotent stem cells are ?
    11·2 answers
  • How many species are currently considered “critically endangered”?
    9·1 answer
  • What can trace fossils tell you about ancient organisms?
    9·2 answers
  • The number of people that can be fed by one United States farmer has increased greatly over the past years. This is largely due
    14·1 answer
  • Ibuprofen is a drug commonly used to relve inflammation and pain, it is a mixture of two enatiomes whicha re moldules that:_____
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!