1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Angelina_Jolie [31]
3 years ago
9

Which statements describe long-term environmental changes? Check all that apply. They occur in minutes or within hundreds of yea

rs. They occur in thousands of years or within billions of years. They affect populations and species more slowly than short-term changes. They have an immediate impact on living things. They can affect the DNA of living things over time.

Biology
2 answers:
Wittaler [7]3 years ago
8 0

Answer: B, C, E

Explanation: I got it correct and here is proof.

Harlamova29_29 [7]3 years ago
6 0

2, 3, 5 (write at least 20 characters)

You might be interested in
A carotenoid is a yellow-orange pigment that absorbs _____ light.
alexandr402 [8]

The correct answer to this question is option"blue-green".

Reason:

The carotenoid is a yellow-orange pigment that absorbs blue light which gives plants there green color.

Therefore the answer should be option B.

Hope this helps!!!

6 0
3 years ago
Read 2 more answers
Jessica's teacher has asked her to bring her 0.40 moles of sodium chloride to the laboratory. she should bring approximately ___
tigry1 [53]
ʜᴇʟʟᴏ ᴛʜᴇʀᴇ!
_________________________________________________________

Formula mass of NaCl = 58.5g
0.4 x 58.5 = 23.4
She should bring approximately 23.4 grams.
_________________________________________________________

нσρє тнιѕ нєℓρѕ уσυ!
gσσ∂ ℓυ¢к :)
нανє α gяєαт ∂αу 
 

- нαηηαн ❤
6 0
3 years ago
What is the basic unit of structure and function in plants, animals, and bacteria?
padilas [110]

Answer:

The cell is the basic structural and functional unit of life. Cells are independent, single-celled organisms that take in nutrients, excrete wastes, detect and respond to their environment, move, breathe, grow, and reproduce.

lil more info

What is the basic unit of structure and function in plants and animals?

Cell Theory !

All living things are made of cells. The cell is the basic unit of structure and function in all living things.

Can i have brainlist?

4 0
3 years ago
Spherocytosis is a human blood disorder associated with a defective cytoskeletal protein in the red blood cells (rbcs). what do
Alex17521 [72]
In spherocytosis, there is a defect in the membrane proteins of the red blood cells, specifically ankyrin and spectrin. These membrane proteins contribute to the biconcave shape of red blood cells therefore the loss of these proteins will lead the red blood cells to lose its biconcave shape--leading to abnormally shaped red blood cells (spheres) hence the name. This can lead to premature destruction of red blood cells and jaundice due to hyperbilirubinemia. Spherocytes do not hold oxygen and carbon dioxide well as spherocytes have a decreased surface area.
4 0
3 years ago
Due to the fact that ice is less dense than water inrits liquid form Select one:
shtirl [24]
Hey i think the answer is A
5 0
3 years ago
Other questions:
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Where should an infosec unit be placed within an organization? where shouldn't it be placed?
    12·1 answer
  • Dreams are not acted out thanks to rem's protective _____.
    15·1 answer
  • Someone help me asap lol thanks
    12·1 answer
  • What nucleotide pairs with with T?with C?
    10·1 answer
  • A space shuttle travels at the rate of 3,094 miles per hour to reach its orbit at a height of 300 km from Earth. If 1 kilometer
    9·2 answers
  • The overall long-term effects of air pollution are not yet certain.<br><br><br> True False
    15·2 answers
  • When explaining to your friend how to use a food processor, what are 2 pieces of important information to remember?
    7·1 answer
  • What determines why some traits are "favorable"?
    6·1 answer
  • Why is it important that psychologists understand biology in their efforts to better understand behavior and mental processes?
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!