1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sonbull [250]
3 years ago
12

which human activity is not a significant factor in impacting the planet? industry agriculture urban development traveling

Biology
1 answer:
vagabundo [1.1K]3 years ago
7 0
U tell me idk what that is
You might be interested in
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
2 years ago
Give three examples of a stimulus and a possible response in humans
solmaris [256]
The three examples of stimulus include;
1. Hit the skin with a needle or pin is a good example of stimulus. The sudden removing of the hand is the response.
2. When somebody bangs a door you jump if you were unaware because of the sound. The jumping is the response to a stimulus.
3. Holding a hot plate we fling hand away from it. The stimulus here is holding the plate while removal of the hand is the response.
Stimulus is the change or cause in an organism's surrounding which causes the organisms to react.

4 0
3 years ago
Read 2 more answers
What are the steps of DNA Replication in order?
slega [8]

Explanation:

1) The enzyme helicase catalyses the unwinding of the two DNA strands by disrupting the hydrogen bonds between complementary base pairs.

2) Single-stranded binding proteins attach to the DNA strands to stabilise them and prevent them from joining back together.

3) The enzyme primase catalyses the addition of a short primer consisting of RNA nulceotides to the DNA strand. This serves as an 'anchor' DNA polymerase to initiate replication.

4) The enzyme DNA polymerase synthesizes a new DNA strand by incorporating DNA nucleotides complementary to the existing strand. DNA polymerase activity only occurs in the 5' ---> 3' direction.

5) The enzyme ligase catalyses the formation of hydrogen bonds between the two new pairs of DNA strands, and seals any breakages in the sugar-phosphate backbone.

6 0
2 years ago
The goal of basic science is:
Hunter-Best [27]

Answer:

B. to understand the world around us

Explanation:

4 0
3 years ago
Read 2 more answers
You are on the scene in the bad part of town for an unresponsive 18-year-old type 1 diabetic patient. his mother states that he
Margaret [11]
<span>The answer would be: Continue patient care by getting a complete SAMPLE history and perform a complete secondary assessment.

If the reading of glucose test is normal, then you can exclude hypoglycemia from the possible diagnosis. Because the patient is accompanied by his mother, you can ask a brief history to exclude other possible diagnosis and complete secondary assessment before further help comes. The information would be beneficial to the healthcare personnel that will comes for help.
</span>
8 0
3 years ago
Other questions:
  • The meninges is a three-layered, membranous covering of the brain and spinal cord. Read the descriptions below and then click an
    5·1 answer
  • 3 mutations frameshift mutation how im going to remeber this meaning answer
    9·1 answer
  • Assuming no crossing over between the gene in question and the centromere, during what phase of meiosis do alleles segregate?
    10·1 answer
  • Data collection relies entirely on scientific experiments? true or false
    10·1 answer
  • HELP HELP HELP WHATS 1+1 IM STUCK ITS SO HARD PLEASE HELP ME QUICK
    14·1 answer
  • 3) Part of a process necessary for reproduction in complex organisms is represented below. Step C results in the production of A
    15·1 answer
  • What did humans in England do to change the tree trunks in mid 1800's?
    6·2 answers
  • What do stomata Get from the environment?
    8·2 answers
  • What are the three important ways in which humans differ from other animals with regard to communication systems
    5·1 answer
  • perspective that our genes and environmental influences work together to determine our characteristics
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!