1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Leona [35]
3 years ago
14

A. Left skewed b. Right skewed C. Symmetric d. Symmetric with outliers

Mathematics
1 answer:
mote1985 [20]3 years ago
6 0

Answer:

1. a: left skewed

2. c: symmetric

You might be interested in
Which point is located at (0,8)
nataly862011 [7]

The point (0, 8) simply means the x axis is 0 while the y axis is 8. The answer is C.

5 0
1 year ago
How much will he spend if he buys 4 pizzas and 5 drinks?
gtnhenbr [62]

Answer:

How much is each pizza and how much is each drink? set up your equation as 4p+5d = (your answer)

Step-by-step explanation:

3 0
3 years ago
HELP PLS
const2013 [10]
The answer is square pyramid hope this helps
4 0
3 years ago
Read 2 more answers
Burj l Arab Hotel,one of the world's tallest buildings,was finished in 1999.Located in Dubai,it is 1,053 feet high with 60 stori
AlexFokin [52]

Each floor is 3.35 feet taller than each floor of the Aon Center


5 0
2 years ago
What is the area of this figure? <br><br> ____ units²
skad [1K]
To solve the problem we could separate the figure into three parts. First figure is a triangle, second figure is a rectangle, third figure is a triangle. See image attached.

Solve each area of the figures
First figure, a triangle that have 7 units long of the base, and 2 units long of the height.
a = 1/2 × b × h
a = 1/2 × 7 × 2
a = 14/2
a = 7
The area of the first figure is 7 units²

Second figure is a rectangle, the length of the rectangle is 7 units, the width of the rectangle is 4 units.
a = l × w
a = 7 × 4
a = 28
The area of the second figure is 28 units²

Third figure is a triangle, the base is 7 units long and the height is 2 units long.
a = 1/2 × b × h
a = 1/2 × 7 × 2
a = 14/2
a = 7
The area of the third figure is 7 units²

The area of the three figures
area = first figure area + second figure area + third figure area
area = 7 + 28 + 7
area = 42
The total area of the figures is 42 units²

5 0
3 years ago
Other questions:
  • to serve 1 person at a local restaurant it takes 10 minutes to serve pie people it takes 18 minutes write and solve an equation
    9·1 answer
  • How do i solve the problem
    7·1 answer
  • Reynaldo rode his bike 2 miles north and 3 miles east. Which equation should he use to find the distance, d, that takes him dire
    11·2 answers
  • If a marble is randomly chosen from a bag that con-
    7·2 answers
  • Which is a good comparison of the estimated sum and the actual sum of 7 9/12 + 2 11/12
    6·1 answer
  • Evaluate the following expression when n = -7.<br><br> -9|n + 5|
    11·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • Find the value of x in the isosceles triangle shown below.<br> 2<br> 2<br> 5<br> 8
    7·1 answer
  • What's the answer plz help!!!
    9·1 answer
  • Please help!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!