1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
SVEN [57.7K]
3 years ago
13

Using complete sentences, describe the uses for dams and reservoirs.What type of power do they generate

Biology
2 answers:
Nat2105 [25]3 years ago
6 0

Answer:

Uses of dams and reservoirs:

1) Dams and reservoirs are used to store water which flows through lakes and rivers.

2) It is used for the production of electricity by moving turbines with the flow of water.

3) It also helps in the control of flood.

4) Water that is stored in dams and reservoirs are used for irrigation of field.

mrs_skeptik [129]3 years ago
5 0

Answer:

Uses of dams and reservoirs:

1) Dams and reservoirs are used to store water which flows through lakes and rivers.

2) It is used for the production of electricity by moving turbines with the flow of water.

3) It also helps in the control of flood.

4) Water that is stored in dams and reservoirs are used for irrigation of fields.

Dams generally generates power in the form of electricity.

You might be interested in
He sequence of ________________ in a DNA molecule determines the protein that will be produced.
miss Akunina [59]
<span> nucleotide bases
</span>https://www.google.com/search?q=He+sequence+of+________________+in+a+DNA+molecule+determines+the+pro...
7 0
3 years ago
Mc013-1.jpg Which viral shape is shown? complex polyhedral helical enveloped
Aleksandr-060686 [28]
Hello There!

If i remember correctly from doing this question before, the answer was Helical.

Hope This Helps You!
Good Luck :) 

- Hannah ❤
4 0
4 years ago
Read 2 more answers
What sensory information is encoded for by hair cells in the maculae of the saccule and utricle? What is the function of the oto
Fittoniya [83]

Answer and Explanation:

The sensory information encoded for by the hair cells in the maculae of the saccule and utricule are:

  • the direction and strength of mechanical stimuli (polarity information)
  • Response to the head's rotational movement

Functions of the otoliths

The otoliths provide balance, movements and serve as directional indicators in vertebrates. They help higher vertebrates in sound detection.

Functions of the vestibular nuclei

  • Maintenance of equilibrium and posture
  • Modification of muscle tone
  • Relays information to the cerebral cortex
  • Directing the movements of the head and eye
  • Maintaining the line of vision
6 0
3 years ago
A codon is a set of three nucleotides that correspond to a specific amino acid. The table below shows various DNA codons and the
Finger [1]

Answer:

1a. The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

b. The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d. The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

2. Below is a table for the genetic code:

T

C

A

G

T

TTT Phe (F)

TTC "

TTA Leu (L)

TTG "

TCT Ser (S)

TCC "

TCA "

TCG "

TAT Tyr (Y)

TAC "

TAA Stop

TAG Stop

TGT Cys (C)

TGC "

TGA Stop

TGG Trp (W)

C

CTT Leu (L)

CTC "

CTA "

CTG "

CCT Pro (P)

CCC "

CCA "

CCG "

CAT His (H)

CAC "

CAA Gln (Q)

CAG "

CGT Arg (R)

CGC "

CGA "

CGG "

A

ATT Ile (I)

ATC "

ATA "

ATG Met (M)

ACT Thr (T)

ACC "

ACA "

ACG "

AAT Asn (N)

AAC "

AAA Lys (K)

AAG "

AGT Ser (S)

AGC "

AGA Arg (R)

AGG "

G

GTT Val (V)

GTC "

GTA "

GTG "

GCT Ala (A)

GCC "

GCA "

GCG "

GAT Asp (D)

GAC "

GAA Glu (E)

GAG "

GGT Gly (G)

GGC "

GGA "

GGG "

a. The following codons can be mutated by one base to produce an amber codon:

CAG    Gln

AAG    Lys

GAG    Glu

TCG    Ser

TTG    Leu

TGG    Trp

TAA    Stop

TAT    Tyr

TAC    Tyr

b. From part a, CAG (Gln) and TGG (Trp) can become amber stop codons through EMS.

c. From part b, both of the resulting amber codons could be suppressed by amber nonsense suppressors generated by EMS.

3a. The codon is the three nucleotide sequence in the mRNA that indicates which amino acid should be incorporated in the growing polypeptide chain.  The anticodon is the complementary three nucleotide sequence in the appropriate tRNA.

b. Template strand is the DNA strand off which the mRNA is synthesized.  The coding, or non-template, strand is the DNA strand complementary to the template strand; it has the same sequence (except for T for U substitutions) as the mRNA.

c. The Pribnow box is a sequence of six nucleotides (TATAAT) positioned at -10 that signals where transcription initiation should begin in prokaryotic DNA.  The Shine-Delgarno sequence is a short, purine-rich region in the mRNA that is complementary to the rRNA within the 16S ribosomal subunit.  The sequence signals which AUG acts as the translation start in mRNA.

4a. False, a wobble allows the anticodon in the tRNA to hybridize with different codons in mRNA.

b. False, a frameshift mutation affects all the subsequent amino acids.

c. False, only one codon (AUG) encodes for the start of protein synthesis; three codons signal the end of protein synthesis.

d. False, the wobble is first base (5’ to 3’) in the anticodon.

e. True, RNA can be used as a template for DNA synthesis in a process known as reverse transcription.

f. True.  For example, a single base substitution causing CAT to change to AAT would signal a termination.

g. False, the Wobble Hypothesis explains how alternate base pairing can occur with the first nucleotide (going from 5' to 3') in the anticodon.

5a. Digestion of RNA with alkali will cleave the strand after each 3’ phosphate.  Therefore, the products remaining will consist of pppNp, Np, and N-OH

b. If RNA was synthesized in the 3’ to 5’ direction (i.e. by adding ribonucleotides to the 5’ end), then the pppNp and Np fragments should be labeled with tritium.

c. If RNA was synthesized in the 5’ to 3’ direction (i.e. by adding ribonucleotides to the 3’ end), th

Explanation:

6 0
3 years ago
6.
EastWind [94]
The answer is A.

Hope this helps :)
7 0
3 years ago
Other questions:
  • To be certain that the extract prepared from virulent cells still contained the transforming principle that was present prior to
    7·1 answer
  • Briefly define and explain the differences between nature and nurture (GENERAL PSYCHOLOGY QUESTION BTW !!!!!!). ​
    10·1 answer
  • Angelique has several symptoms of pneumonia that her doctor diagnoses as being caused by a virus. Her parents ask for an antibio
    5·2 answers
  • How is dna the basic of life?
    11·1 answer
  • What directs and controls a animal cell activities?
    7·1 answer
  • How does ATP provide energy to your body?
    15·2 answers
  • I really need help with this
    14·1 answer
  • What are elements found in proteins
    13·2 answers
  • From a population of red, brown, orange, yellow, and green butterflies, only the red and green ones survive since they can blend
    5·1 answer
  • Which of the following graphs best shows the relationship between the reaction rate of an enzyme-catalyzed reaction and substrat
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!