1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
White raven [17]
3 years ago
11

Which of the following plants is commonly propagated from a scion and rootstoch

Biology
1 answer:
Nina [5.8K]3 years ago
4 0
Apple Tree hope this helps
You might be interested in
Match each image with the life function the organism is performing. 1.reproduction
Lorico [155]

Answer:

1. Obtaining energy

2. responding to a stimulus

3. reproduction

4. excretion

Explanation:

1. All living organisms require energy for their life processes. This energy is derived from food. The food we eat contains biomolecules that store energy. The energy stored by these food molecules is released by a process called RESPIRATION. Image 1 shows a cat trying to obtain energy by feeding. The food will eventually be broken down to release energy.

2. Stimulus is any thing (whether internal or external) that causes a change in an organism. In image 2, a man is responding to a sudden change in his back, which is pain.

3. Reproduction is a characteristics of living organisms that involves the production of young ones. Image 3 depicts two cells undergoing fertilization (fusion of nuclei) to produce a new cell. In turn, the cell divides again to form two gametes. The cycle continues like that.

4. Excretion is the removal of waste products from a cell. According to Image 4, the cell allows a food particle in and releases the waste contents out of the cell.

5 0
3 years ago
Read 2 more answers
Andy is studying the effect of sunlight on the growth of plants. He selected three identical plants with a height of 15 cm for t
Serggg [28]

Answer:

Analyze the data

Explanation:

A hypothesis is first coined before the experiment is conducted. Usually is a null hypothesis of no change. In this case it would most probably be ‘The is no relationship between the amount of sunlight that a plant receives and it's growth’

After the experiment, the observed data is collected and analyzed using statistical methods. The result of the data will determine where the null hypothesis will be adopted or rejected.

Research is done way before the experiment is conducted to provide headway.

8 0
3 years ago
What evidence supports a conversation law?
kirill115 [55]

Explanation:

The evidence that supports the conservation law is that Carbon dioxide becomes glucose and oxygen during photosynthesis. The law of conservation of mass states that in a chemical reaction, mass is neither created nor destroyed.

6 0
3 years ago
Read 2 more answers
In his attempt to develop a pneumonia vaccine, Frederick Griffith injected mice with various combinations of living and dead bac
n200080 [17]

Answer:

The mice died

Explanation:

In Griffith's experiment, two strains of the same bacteria were used. S strain was smooth because it had a polysaccharide coat. This coat also made it virulent because mouse immune system was not able to destroy it and ultimately the mice died. R strain was rough because it did not have the coat and thus was harmless to mice.

When Griffith injected mice with dead S bacteria and living R bacteria together, the mice died. Live R bacteria had taken up the genetic material or as Griffith called "transforming principle" from the dead S bacteria and transformed into S bacteria. So live S bacteria were present again and they killed the mice.

4 0
3 years ago
In general, due to the laws of physics, as magnification increases in a microscope, the field of view A) blurs. B) decreases. C)
erica [24]

The answer is Decreases

5 0
3 years ago
Other questions:
  • A single strand of DNA is ATTCGGCTATTTACGATTGCCAT what is the other strand?
    8·1 answer
  • Many fungi grow a mass of hyphae usually hidden within the material on which it is growing. What is this mass of hyphae called?
    5·1 answer
  • Does the example ( picture ) describe science or pseudoscience?
    7·1 answer
  • ANSWER THIS ASAP WILL MARK BRAINLIEST EXTREME POINTS ANSWER NUMBER 21 ONLY
    11·1 answer
  • In eukaryotic cells the first step in protein synthesis is the _____.
    9·1 answer
  • Eukaryotic cells have organelles within each cell that are bound by their own lipid bi layer membrane ( t or f)
    13·1 answer
  • What are the 5 main steps into the formation of the Solar System??
    9·1 answer
  • The current theory of the structure of the plasma membrane is best described by the what model
    13·1 answer
  • The Venn diagram compares aerobic respiration and anaerobic respiration, Which statement could be categorized in the overlapping
    14·1 answer
  • Which statement about a catalyst is correct?
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!