1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Flauer [41]
3 years ago
10

Which is flatworms locomotory organ tell the answer in full sentence ​

Biology
2 answers:
GalinKa [24]3 years ago
7 0
When it comes to flatworms the organ attaches to the host tissues the attachment occurs during mating
just olya [345]3 years ago
5 0

Answer:

Movement in some flatworms is controlled by longitudinal, circular, and oblique layers of muscle

hope this helped you

please mark as the brainliest (ㆁωㆁ)

You might be interested in
Which of the following is not an example of interactions between biotic and abiotic factors in an ecosystem? A. flowers opening
IRISSAK [1]
In biology, the biotic factors pertain to the living components of Earth while the abiotic factors are those non-living chemicals and physical factors. The only choice that is not an interaction between biotic and abiotic factors is the third choice, "C. male elk fighting over a female". 
8 0
3 years ago
Read 2 more answers
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
The year graphs shown below represent hours of daylight and solar energy for what location?
Ne4ueva [31]

b. Arctic Circle (66.5° N)

3 0
3 years ago
Nucleic acids include
a_sh-v [17]

Answer:

1. DNA and RNA I'm pretty sure

3 0
3 years ago
Read 2 more answers
Which phase of mitosis is shown in the diagram
Lorico [155]

If there's this picture in the question, the right answer is metaphase.

A metaphase qualifies a phase of meiosis or mitosis (following prophase and preceding anaphase) during which chromosomes, or at least kinetochores, align with the equatorial plate of the spindle. At this stage, chromosomes are at their maximum condensation and karyotypes are usually established. In the first division of meiosis, the metaphase represents the phase during which meiotic analysis is usually accomplished.


3 0
3 years ago
Read 2 more answers
Other questions:
  • A particular neutral uranium atom has 92 protons, 143 neutrons, and an atomic mass of 235. how many electrons does the atom have
    10·2 answers
  • Which occurs in both the lytic cycle and the lysogenic cycle?
    9·2 answers
  • A 9-year old child suddenly collapsed. after comfirming the scene is safe, a single rescuer determines that the child is in card
    14·2 answers
  • Joints that have bone ends held together by a joint capsule are structurally classified as ------- joints
    7·1 answer
  • Pick twenty foods and research the amount of total carbohydrates, sugars, and other carbohydrates in them. Note: Most food label
    8·2 answers
  • Which are units used to express volume?
    9·2 answers
  • What can be concluded from the graph? A) The decay in the population is not linear. B) The diseased population increases with ti
    14·1 answer
  • What do you think the biggest weakness is of sharks?
    13·1 answer
  • A well tested concept that explains a wide range of observations. True or False
    14·1 answer
  • Final question pls help me
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!