1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
lisabon 2012 [21]
3 years ago
14

What are the values of sin α and tan α, if: cosα=0.6

Mathematics
1 answer:
olganol [36]3 years ago
6 0

Positive cosine is first or fourth quadrant.  So we don't know the sign of the sine or the tangent.

Everybody's favorite right triangle is 3/4/5 and here we have

\left(\dfrac 3 5 \right)^2 + \left(\dfrac 4 5 \right)^2 = 1

So if

\cos \alpha = 0.6 = \dfrac 3 5

then

\sin \alpha = \pm \dfrac{4}{5} = \pm 0.8

and

\tan \alpha = \dfrac{\sin \alpha}{\cos \alpha} = \dfrac{\pm 0.8}{0.6}=\pm \dfrac 4 3

You might be interested in
Create your own real world problem that involves designing a 2D shape.
andrey2020 [161]

Answer:

A square with 20ft sides is put on the moon

Step-by-step explanation:

what is perimeter

sides = s

s x 4/4 = 20

s = 20

s x 4 = 80

8 0
3 years ago
Read 2 more answers
It is 2.3 km from Salma's house to the nearest mailbox. How far is it in meters?
Ivenika [448]

Answer:

2.3km in meters is 2300 Meters

Step-by-step explanation:

Multiply the length value by 1000

7 0
3 years ago
Roberto deposited $5,000 into an account with 4.2% interest, compounded monthly.
Marina86 [1]

Answer:

$50,581.9

Step-by-step explanation:

8 0
3 years ago
Which of the following expressions is equal to 5-2m?
fiasKO [112]
The answer would be A. Make sure you also use BEDMAAS, and take care of the brackets first
6 0
3 years ago
Blank divided by blank equals 6 what is the two blanks
Travka [436]
36 by 6 blah blah blah
4 0
3 years ago
Read 2 more answers
Other questions:
  • Each foot has 5 toes. How many toes do 6 feet have?
    11·1 answer
  • Determine whether each relation is a function. Explain as well please.
    7·1 answer
  • What is the missing the step in this proof<br> DE = 1/2AT<br> DE = AT
    15·1 answer
  • Walter walked 15.5 blocks from his house to work. It took him 35 minutes. What is his rate in blocks per hour?
    7·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • What is an equation of the line that passes through the point (-1,-3)(−1,−3) and is perpendicular to the line x-2y=14x−2y=14?
    8·1 answer
  • A function has f''(x) = 10 and has f'(4) = 0 and f(2) = 4. Find f(x)
    14·1 answer
  • HELPPPPPPP PLSS!!!!! determine whether the system of equations has 1 solution, no solution, or infinitely many solutions.
    14·2 answers
  • Pedro brought 8 tickets to a basketball game. He paid a total of $208.
    6·1 answer
  • Ms. LaTrace teaches her 27 students to make folded-paper princesses. Each student can make about 2 princesses in 1 minute. ABOUT
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!