1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
olganol [36]
3 years ago
12

Give 3 examples of how technology has influenced human population growth

Biology
2 answers:
andriy [413]3 years ago
6 0

Alternating current electricity. This allowed electricity to flow further than Edison's first DC approach.

Railroads - allowed for transportation of materials to growing small cities, and large cities to become larger.

Antibiotics and antiviral medicines. - stopping deadly diseases and bacteria from spreading. This helped with many problems that would normally terminate 33% of populated areas that are infected.

xz_007 [3.2K]3 years ago
4 0

Alternating current electricity. This allowed electricity to flow further than Edison's first DC approach. 

Railroads - allowed for transportation of materials to growing small cities, and large cities to become larger.

Antibiotics and antiviral medicines. - stopping deadly diseases and bacteria from spreading. This helped with many problems that would normally terminate 33% of populated areas that are infected.



You might be interested in
BIOLOGY DEFINTION Genotype:
Alchen [17]

Answer:

Genotype: is the group or collection of genes responsible for the genetic traits of an organism.

I hope this helps :)

5 0
3 years ago
Read 2 more answers
Using the table on the right as a guide, answer the following questions about light-independent reactions. What are the requirem
Jobisdone [24]

Answer:

The correct answer is

- Carbon dioxide, ATP, and NADPH,

- In the stroma of the chloroplast.

Explanation:

The product of the light-dependent reaction that uses in the Calvin cycle or the light independent cycle. Calvin cycle is the light independent cycle that involves the production of the glucose by converting carbon dioxide and other products of light reaction.

The light-independent reaction takes place in the stroma a fluid-filled region of the chloroplast in the photosynthetic organisms.

Thus, the correct answer is -  

- Carbon dioxide, ATP, and NADPH,

- In the stroma of the chloroplast.

7 0
3 years ago
Which change would the nurse anticipate after administering oxygen to a cyanotic infant with uncorrected tetralogy of fallot?
pav-90 [236]
<span>Skin tone of the baby should become pinker. The oxygen level of the baby should rise and be closer to normal. The pulse oximeter should have an improved reading and quit alarming.</span>
5 0
3 years ago
PLS SOMEONE!!! ILL GIVE BRAINLIEST!! HELP
zhenek [66]

Answer:

A or 3 (Wether wich one is on your test) I TOOK THE TEST

Ill take brainliest

100% Verified

Explanation:

i took the test :D

8 0
3 years ago
___________ refers to the living parts of an ecosystem.​
almond37 [142]

Answer:

Living components...

Explanation:

5 0
3 years ago
Read 2 more answers
Other questions:
  • HELPPPPPPP CHECK .................
    7·2 answers
  • What part of the Respiratory System works as a gate keeper to prevent water and food from going down the trachea?
    7·1 answer
  • Certain organisms are able to store energy from the sun in energy-rich compounds.which event best illustrates this activity?
    12·1 answer
  • I need to match the definitions with the words.
    13·1 answer
  • A freshwater is a type of ecosystem. Grasses, fish, wading birds, frogs, and alligators live together in fresh water marshes. Pi
    7·2 answers
  • How do the chloroplasts help the sea slug
    14·1 answer
  • Bipedalism has traditionally been viewed as an adaptation to open grassland or savanna country, although Ardipithecus lived in a
    8·1 answer
  • How are Eisenhower's leadership qualities as Supreme Commander of the Allied Forces on D-Day characterized?
    9·1 answer
  • AGGUCAUGCAUGGGCAUGCAU tRNA sequence for the given strand of mRNA
    8·1 answer
  • (6th grade science) Why do temperatures on Earth Increased when the amount of carbon dioxide?​
    7·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!