Which level of organization describes the stomach?
B.) organ
Where is starch in food first digested in the digestive system?
The mouth and small intestine both have a part in digesting starch, but the keyword is "first" so of course that would be:
A.) mouth
Hope this helped. I believe I am right, but correct me if I'm wrong. :)
Viruses depend on the host cells that they infect to reproduce. When found outside of host cells, viruses exist as a protein coat etc.
true.
Answer:
B. 1,000,000
Explanation:
A pH of 14 is 1 x 10^-14 while a pH of 8 is 1 x 10^-8.
So, all we have to do is subtract 8 from 14 and then solve it.
14 - 8 = 6
1 x 10^6 = 1,000,000
Avoid carcinogens (like smoking residues..etc), eat healthy and sleep well in order to maintain a strong immune system
Answer:
a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’
(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\
b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’
c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’
(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)
d.The third codon is 5’ ACC 3’. Therefore, the corresponding anti-codon is 5’ GGU 3’
