1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
igomit [66]
4 years ago
13

Biotic factors cannot live without abiotic factors. True False

Biology
1 answer:
sergeinik [125]4 years ago
7 0
Depends, if the biotic factor is a chipmunk or something of that case, its natural habitat is a rock, which is biotic. but...if the animal is something like a deer they don't need abiotic factors. its your chose to chose but I'm leaning more twords false because not ALL biotic factors cant go without an abiotic factor
You might be interested in
In rabbits, short hair (S) is dominant over long hair (s). What genotype and phenotype ratios are
Kazeer [188]

Answer:

Genotype                  Phenotype                      

SS                 1/4          Short hair         3/4

Ss                 2/4         Short hair          3/4

ss                  1/4          Long hair          1/4

Explanation:

The resulting off-spring would have the following genotype and phenotype:

1 out of 4 will have a genotype of SS.

2 out of 4 or half will have a genotype of Ss.

1 out of 4 will have a genotype of ss.

But because short hair is dominant the phenotype ratios would differ because Ss and SS would express short hair, so we add up their ration:

Short hair: 1/4 + 2/4 = 3/4

Long hair:  1/4

3 0
3 years ago
6) African cichlids are a group of closely related fish species. There are at least 500 known species living in three small lake
pogonyaev
It's ADAPTIVE RADIATION because it is <span>the diversification of a group of organisms into forms filling different ecological niches.</span>
3 0
3 years ago
Read 2 more answers
The total magnification of a specimen viewed under a compound light microscope is determined by the power of the objective lens
Nikitich [7]

Answer:

The power of the objective lens multiplied by the power of the ocular lens

Explanation:

6 0
3 years ago
Read 2 more answers
Recent genetic research indicates that ____ or more individuals are needed for an endangered species to maintain its capacity fo
garri49 [273]
The answer would be 2 or more
3 0
3 years ago
Provide two specific examples of harmful bacteria and what diseases they cause
Step2247 [10]

Answer:Common pathogenic bacteria and the types of bacterial diseases they cause include:

Escherichia coli and Salmonella cause food poisoning.

Helicobacter pylori cause gastritis and ulcers.

Explanation: i take advanced biology and we learning about what harmful diseases that bacteria can create

5 0
3 years ago
Other questions:
  • Contractile proteins are found in _____.<br> eggs<br> muscles<br> feathers<br> seeds
    14·1 answer
  • How does pollution cause a reduction in biodiversity?
    7·1 answer
  • Identify the following as plot or theme. A man learns that his love for a dolphin is more important to him than his career. plot
    6·1 answer
  • Percentage for the time a cell spends in MITOSIS?
    10·1 answer
  • What education do veterinarians need to complete before working
    9·1 answer
  • Almost all the energy and associated biomass in Earth's ecosystems comes from the
    10·1 answer
  • Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
    5·1 answer
  • What separates during meiosis?
    8·1 answer
  • What is the difference between a specialized plant cell and a specialized animal cell?​
    8·1 answer
  • Potential buyers within a market segment should be.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!