1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
noname [10]
4 years ago
8

Organ where pancreatic enzymes and bile enter the alimentary canal

Biology
1 answer:
Talja [164]4 years ago
5 0

Answer: Doedunum

Explanation: Doedunum is a hollow tube that forms part of the digestive tract. It is attached to the pyloric sphincter of the stomach and to the jejunum of the small intestine, that way it plays a huge role in receiving chyme(food) from the stomach and pass it to the small intestine for absorption. Food in the doedunum is taken as signal that initiate enzymatic digestion. Pancreatic juices, bile salts and other enzymes enter the doedunum when it a receives signal that there is food that needs to be digested, broken down by enzymes, then passed on to the jejunum for absorption.

You might be interested in
Which of the following would be distributed throughout a prokaryotic cell, but would be
tensa zangetsu [6.8K]

Answer:

a

Explanation:

8 0
2 years ago
2. The learners then wanted to investigate whether exercise has an effect on heart rate.
g100num [7]

Answer:

b

Explanation:

6 0
3 years ago
5. The Nucleolus is small, dense object found in the middle of the nucleus. It makes the RNA for the cell.
SIZIF [17.4K]

Answer:

b

Explanation:b

6 0
3 years ago
What might happen to a plant if the roots grew away from the pull of Earth’s gravity?
Darina [25.2K]
:) !! hope this helps ! have a great day. :D

5 0
2 years ago
Read 2 more answers
Name the function of water in saliva
sashaice [31]

Answer:

Moistening food and helping to create a food bolus so food can be swallowed easily

7 0
3 years ago
Other questions:
  • Describe a way in which genetic engineering has helped criminal justice? I'm kinda confused by this. xD
    10·2 answers
  • What is the function of meiosis rather than a function of mitosis
    5·1 answer
  • Organizing the Human Body
    10·1 answer
  • You discover a new organism while on vacation in Yellowstone Park. You use a series of experiments to establish that it carries
    7·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Which hypothesis regarding the evolution of hominin bipedalism suggests that this energy-efficient trait arose so that hominins
    14·1 answer
  • The cells produced during meiosis are?
    13·1 answer
  • Difference between eukaryotic cells and prokaryotic cells.​
    8·2 answers
  • Plant cells contain chlorophyll. What is the role of chlorophyll in plant cells?
    13·2 answers
  • Please help for biology
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!