1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
laila [671]
3 years ago
14

Micahdisu please help

Mathematics
2 answers:
skad [1K]3 years ago
4 0

Answer:

1) A - 42°

2) 74°

3) B - 45°

4) B - 66°

Step-by-step explanation:

1) E = D+H

87 = 45 + H

H = 42°

2) 180 - 50 - D

D = 180 - 44 - 62 = 74°

3) F = 105

H = 180-105 = 75

I + H = C + E

I + 75 = 83 + 37

I = 45°

4) D = 180 - (E + F)

D = 180 - (30 + 57) = 93°

93 = A + 27

A = 66°

slamgirl [31]3 years ago
3 0

Answer: In figure 1, angle H = 42°. In figure 2, angle F = 56°. In figure 3, angle I = 45° and in figure 4, angle A = 66°

Step-by-step explanation: Please refer to the attached diagram for details.

From figure 1, if angle E measures 87, then angle F would be calculated as

Angle F = 180 - 87 {Sum of angles on a straight line equals 180}

Angle F = 93

Then looking at triangle FHD, we have angles D and F as 45 and 93. Angle H = 180 - (45 + 93) {Sum of angles in a triangle equals 180}

Angle H = 180 - 138

Angle H = 42

From figure 2, if triangle ACB has two angles given as 44 and 62, then the third angle C, would be calculated as

Angle C = 180 - (44 + 62) {Sum of angles in a triangle equals 180}

Angle C = 180 - 106

Angle C = 74

Note that angle D equals angle C {Opposite angles are equal}. So if angle D measures 74, then looking at triangle FED, we have two angles already, E and D which are 50 and 74. To calculate angle F, the equation would be

f = 180 - 50 - 74

f = 56

That is, angle F = 56.

From figure 3, we have angles C and E given as 83 and 37. To calculate angle G

Angle G = 180 - (83 + 37) {Sum of angles on a straight line equals 180}

Angle G = 180 - 120

Angle G = 60

Also, to calculate angle H,

Angle H = 180 - 105 {Sum of angles on a straight line equals 180}

Angle H = 75

Looking at triangle GHI, we have identified two angles which are 60 and 75. To calculate the third angle which is angle I,

Angle I = 180 - (60 + 75) {Sum of angles in a triangle equals 180}

Angle I = 180 - 135

Angle I = 45

From figure 4, if angles B and E measure 27 and 30 respectively then the whole of that angle measures 27 + 30 which equals 57.

So looking at the biggest of all three triangles, two angles have been identified which are angles F and {B + E}

To calculate angle A

Angle A = 180 - (57 + 57) {Sum of angles in a triangle equals 180}

Angle A = 180 - 114

Angle A = 66.

You might be interested in
Mike observed that 75% of the students of a school liked skating. If 35 students of the school did not like skating, the number
Lubov Fominskaja [6]
35 students   -    25 % ( or 1/4 of the all students )
35 * 4 = 140
140 - 35 = 105
Answer:
The number of students who liked skating was 105.
5 0
3 years ago
Read 2 more answers
What is the 30th term of the linear sequence below?<br><br> -5,-7,-9,-11,-13....
adelina 88 [10]

Answer:

-63

Step-by-step explanation:

This arithmetic progression

The formula is a+(n-1)d

a means the first value

n is the nth term

d is the difference

So a is -5

n is 30

d is -2

So let's substitute

-5+(30-1)-2

-5+(29)-2

-5-58

-63

Therefore the final answer is-63

Just follow the step and the general formula, you will get your final answer

3 0
3 years ago
the rope Roz brought with her camping gear is 54 inches long. Roz needs to cut shorter pieces of rope that are each 8 inches lon
KatRina [158]

Answer: 6

Step-by-step explanation:

8x6=48 you would have 6 inches left over

7 0
3 years ago
Can someone please help me, thanks!!
krok68 [10]
6)
3(n + 4)  < - 62

8) 

   n/3  -  2

hope it helps


4 0
4 years ago
Please help im struggling on this ​
Ksivusya [100]

Answer:

It looks like you cut off part of the questions...

Step-by-step explanation:

8 0
3 years ago
Other questions:
  • Amanda apent 2$ more than Barry on school supplies together they spent
    13·2 answers
  • Can someone explain this to me pls
    15·2 answers
  • What is the distance from -12 to -5<br><br><br><br><br> 5<br><br><br><br> 7<br><br><br><br> 17
    14·2 answers
  • I’m a bit stuck, please help
    7·1 answer
  • Karl needs to build a stage that has an area of 72 square feet. The length of the stage should be longer than the width. What ar
    10·1 answer
  • What is 6+4? I am so confused HELPPPPPP MEEEEE
    12·1 answer
  • Andrew soccer team scored 16 goals during the season. Andrew, Danielle, Mel and Renee scored all the teams goals. Andrew scored
    7·1 answer
  • What is the complementary DNA strand for the DNA strand<br> AATTGGCCATGCATGATTACGA
    7·2 answers
  • mitchell has two rectangular prisms. prism B has a height that is twice the height of a prism A. The length and width of prism B
    7·1 answer
  • Solve x in the quadractic x/3 + 10/x-1 = 4.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!