Answer:
The answer is W. chloroform-chloroform and acetone-acetone interactions are stronger than chloroform-acetone interactions. This is because the bond between acetone-acetone is a dipole-dipole interactions and chloroform-chloroform dipole-dipole compared to the weaker hydrogen-bonding between acetone-chloroform.
It turns out that this hydrogen-bonding happens to be stronger the original dipole-dipole forces, so this shows NEGATIVE DEVIATION from Raoult's law.
Answer:
A DNA strand contains the following nucleotide sequence: TACTGCCTCCCCATAAGAATT
Explanation:
<span>UN1825 refers to Sodium monoxide.It is a white granular material. It reacts with water to give sodium hydroxide with the evolution of heat. It is corrosive to metals and tissue. The oxides of sodium and potassium react with water vigorously and with enough evolution of heat to cause boiling and spattering of hot caustic solution.Reaction with water may generate much heat that will increase the concentration of fumes in the air. Fire will produce irritating, corrosive and/or toxic gases. Runoff from fire control or dilution water may be corrosive and/or toxic and cause pollution.</span>
